ID: 1064764753

View in Genome Browser
Species Human (GRCh38)
Location 10:18659547-18659569
Sequence GCGCGGGCTGCGCGGAGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 356}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064764753_1064764764 2 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764764 10:18659572-18659594 CGGTGGGGGACCCGGCGCAGCGG 0: 1
1: 0
2: 0
3: 22
4: 233
1064764753_1064764762 -6 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764753_1064764767 17 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764767 10:18659587-18659609 CGCAGCGGCACCTGCTGCCGAGG 0: 1
1: 0
2: 1
3: 24
4: 215
1064764753_1064764770 27 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764770 10:18659597-18659619 CCTGCTGCCGAGGGACCCCGCGG 0: 1
1: 0
2: 2
3: 16
4: 181
1064764753_1064764768 18 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764768 10:18659588-18659610 GCAGCGGCACCTGCTGCCGAGGG 0: 1
1: 0
2: 1
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064764753 Original CRISPR GCGCGGGCTGCGCGGAGCCG AGG (reversed) Exonic