ID: 1064764762

View in Genome Browser
Species Human (GRCh38)
Location 10:18659564-18659586
Sequence CCGCGCCGCGGTGGGGGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064764749_1064764762 22 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764753_1064764762 -6 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764748_1064764762 23 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064764762 Original CRISPR CCGCGCCGCGGTGGGGGACC CGG Exonic
900362068 1:2293911-2293933 CCGCGCCACCATGGGGGTCCAGG + Intronic
902286288 1:15410405-15410427 ACGCACCGGGGTTGGGGACCCGG + Intronic
902768300 1:18631231-18631253 CCCCGCGGCGGAGGGGGGCCGGG - Exonic
903153269 1:21428165-21428187 CCGCGCCGCTGCGGGCGGCCTGG + Intergenic
903219948 1:21864038-21864060 CTGGGCCTGGGTGGGGGACCAGG - Intronic
904027523 1:27513931-27513953 CCGAGTCGGGGTAGGGGACCTGG + Intergenic
905409924 1:37761600-37761622 CCGCGCCACCGTGCGGGGCCTGG - Exonic
905442790 1:38005579-38005601 CCGCGGCGGGCTGGGGGGCCGGG - Intronic
916174186 1:162023954-162023976 CCGCGCGGAGGAGGAGGACCTGG + Intergenic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917919872 1:179742829-179742851 CCCCGCCGCTGAGGGGTACCCGG - Intergenic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
922717975 1:227886874-227886896 CAGCGCCGGGGTGGGGGTCGGGG - Intergenic
1063429766 10:5977977-5977999 CAGGGCCGCGGAGGGAGACCAGG - Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1070152236 10:73811886-73811908 CAGCCCCGCGGAGGGGGAGCCGG + Intergenic
1073059473 10:100724703-100724725 CCGCGCCGGGGTAGGCGAGCAGG + Intergenic
1073110674 10:101061492-101061514 CCGCGCCTTGGTGGGGCAGCTGG + Intergenic
1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG + Intergenic
1075654457 10:124152109-124152131 CCGCTGGGCGGTGGGGGTCCTGG + Intergenic
1076380381 10:130021211-130021233 CCGCGGGACGGTGGGGGACCAGG - Intergenic
1076798520 10:132810187-132810209 TCGCGCCACGGTGGGGGGCTGGG + Intronic
1076798538 10:132810287-132810309 CCGCTTCTCCGTGGGGGACCTGG - Intronic
1076904982 10:133357153-133357175 CCGCCCTGCCCTGGGGGACCTGG + Intronic
1076992047 11:280499-280521 GCGCGCCGCGGTCGGGGCACTGG - Exonic
1077224723 11:1435001-1435023 CCGAGGCGCGGAGGGGGACCGGG + Intronic
1078729469 11:13962614-13962636 CAGCGCTGCGCTGGGGGATCTGG + Intergenic
1082003657 11:47408427-47408449 CCTCGCGGCGGTGGGGGACCCGG - Intronic
1083579168 11:63813838-63813860 CCGCGTCACGGTGCGGGGCCGGG + Intronic
1084129101 11:67119552-67119574 GCGCGCCGGGATGGGGGCCCTGG - Intronic
1085561260 11:77474197-77474219 CCGCGCCGGGGAGGGGGAGTGGG - Intronic
1096204123 12:49707168-49707190 CCCCGCCGCGATGGGCAACCTGG - Exonic
1096413175 12:51391626-51391648 CCGCGCCGCGGGGTGGCTCCCGG + Intronic
1096650689 12:53060692-53060714 GGGCGCTGAGGTGGGGGACCTGG - Exonic
1102913752 12:116737888-116737910 CCGCGCCGGGATGGTGAACCTGG - Exonic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1113378046 13:109782654-109782676 TGGCGCCGCGGTGGGGGTCCGGG + Exonic
1114269398 14:21091915-21091937 CCGCGCCCGGGTGAGGGACCGGG - Exonic
1117478301 14:56118753-56118775 CCGCGCCGCTGCCCGGGACCAGG - Intronic
1118729543 14:68656710-68656732 CCTCTCAGGGGTGGGGGACCTGG - Intronic
1122624209 14:103075807-103075829 CCGCGGAGCGGAGCGGGACCAGG - Intergenic
1122975411 14:105168834-105168856 CCGCGCCGCGGGGTGGGGCCGGG + Intergenic
1127868094 15:63048177-63048199 CCGCGGCGCGGTGGTGACCCGGG - Intronic
1130390067 15:83447456-83447478 CCGCGACGCGCTCGGGGAGCGGG - Exonic
1132889322 16:2196281-2196303 CCGCGCCGGGGAGGGGCCCCCGG + Intronic
1135479921 16:22814073-22814095 CCGCGCCGCGCCCAGGGACCTGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136539947 16:30923638-30923660 CAGCGCGGGGCTGGGGGACCAGG + Intronic
1137056618 16:35749246-35749268 CCGGGCCGCGGTGGGGGCACAGG - Intergenic
1137057156 16:35751262-35751284 CCGGGCCCTGGTGGGGGCCCAGG - Intergenic
1137057539 16:35752774-35752796 CCGGGCCACGGTGGGGGATCAGG - Intergenic
1137058067 16:35754775-35754797 CCGGGCCACGGTGGGGGTGCAGG - Intergenic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1141687318 16:85577770-85577792 CCCTGCTGGGGTGGGGGACCCGG - Intergenic
1142151134 16:88513008-88513030 CCGCGGCCCTATGGGGGACCGGG - Intronic
1143527289 17:7479798-7479820 CTGCGCCGCGCTGGGCCACCGGG + Intronic
1147643195 17:42017594-42017616 CCGCGCCGGGGCGGGAGCCCAGG + Exonic
1148206998 17:45785152-45785174 CCCAGCCGCGGTCGGGGAACAGG - Intronic
1150802272 17:68291573-68291595 CCGCGTCGCGGTCCGGGGCCGGG + Intronic
1152644529 17:81462725-81462747 CCACGCCGCTGTGGGGGACATGG - Exonic
1152928142 17:83097270-83097292 CCACTCCGGGGTGGGGGACTGGG + Intergenic
1153773399 18:8433098-8433120 CGGCGGCGGGGTGGGGGTCCAGG + Intergenic
1153911246 18:9708240-9708262 CCCCGCCGCGGTGGGTCACGTGG - Exonic
1157091776 18:44644894-44644916 CCGCACTGCTGTGGGGGTCCTGG - Intergenic
1158505548 18:58044045-58044067 CCGCGCCGCGCTGGAGGCCCCGG + Intergenic
1160631149 18:80247197-80247219 GCGCCCCGCGGAGGGGGACTGGG - Intronic
1160793951 19:935248-935270 CCAGGCCGCGGCGGGGGGCCGGG + Intronic
1160875878 19:1295978-1296000 CGGGGCCGCGGTGTGGGGCCAGG + Intronic
1161973577 19:7596688-7596710 CCGCGCTGCGGGCGGCGACCGGG + Intronic
1162099864 19:8333275-8333297 CGGCGCCGTGGTGGGGGAGCTGG + Intronic
1163020648 19:14479411-14479433 CCCCGCCACGGTGGAGGATCTGG - Exonic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1166818395 19:45561001-45561023 TCCCTCCGTGGTGGGGGACCGGG + Intronic
1166986083 19:46660721-46660743 CCGGGCGGGGGTTGGGGACCCGG - Intronic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1167631747 19:50629977-50629999 CGGCGGAGCGGTGGGGGCCCAGG - Exonic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
938073112 2:128318678-128318700 CCGCGCCGCTGCGGGCGGCCTGG - Intergenic
942444063 2:176066847-176066869 CCGCCACGCGGTCGGGGACCCGG + Intergenic
942459050 2:176157145-176157167 CCGCGCCGGGCTGGGCGGCCGGG + Intronic
946340218 2:219061378-219061400 CCGGGCCAGGGTGGGGCACCAGG - Intergenic
946382406 2:219358223-219358245 CCCCGCCGCTGTGTGGGTCCAGG - Intergenic
947765388 2:232634162-232634184 TCTCGGCGCGGTGGGGGACGGGG + Intronic
1169143492 20:3238662-3238684 CGGCGCCGCGGTGGGAGCCCCGG - Intronic
1169214739 20:3786524-3786546 CCGCCCCGGGGCGGGGGGCCCGG + Exonic
1169558145 20:6770168-6770190 CCGCGCCGCCCAGGAGGACCTGG - Exonic
1172873080 20:38147858-38147880 GCTAGGCGCGGTGGGGGACCCGG - Intronic
1175521345 20:59604383-59604405 GCGCGCCGGGGTGGGGGAGGAGG - Intronic
1175913055 20:62413758-62413780 CCGGCCCGGGGTGGGGGACGTGG + Intronic
1175994183 20:62805027-62805049 CCGCGCCGCGGGGCCGCACCTGG - Exonic
1176548367 21:8211559-8211581 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1176556259 21:8255765-8255787 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1176567298 21:8394594-8394616 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1176575198 21:8438807-8438829 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1176856987 21:13981374-13981396 CGGCGCCGGGGTGGGGGGACTGG - Intergenic
1176867610 21:14062849-14062871 CGGCGCCGGGGTGGGGGGACTGG + Intergenic
1178518185 21:33266276-33266298 CCGCGCCTCGCGGGTGGACCCGG + Intronic
1179661523 21:42879086-42879108 CCGCGGCGCCGGCGGGGACCGGG - Intronic
1180699570 22:17774155-17774177 CCGCGCCGAGGAGGGCGCCCGGG + Intronic
1181531615 22:23520660-23520682 CAGGGCCGCAGTGGGGGCCCAGG + Intergenic
1184332249 22:43834325-43834347 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332259 22:43834353-43834375 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332294 22:43834465-43834487 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332348 22:43834633-43834655 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332358 22:43834661-43834683 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332393 22:43834773-43834795 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332437 22:43834913-43834935 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332447 22:43834941-43834963 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332483 22:43835053-43835075 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184679847 22:46064570-46064592 GCGCGGCGCGGTGCGGCACCAGG - Intronic
1184680945 22:46071829-46071851 GCGCGGCGCGGAGGGCGACCCGG - Intronic
1185278869 22:49961429-49961451 TCGCGCCGCCCTGGGGGACACGG - Exonic
1203253247 22_KI270733v1_random:127862-127884 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1203261302 22_KI270733v1_random:172943-172965 CCGCGTCGCGGTGGGGGGGCGGG - Intergenic
950043257 3:9933540-9933562 CCGGGACGCGGGGTGGGACCAGG + Exonic
952287292 3:31981206-31981228 GCCCGCCGCGGTGGCGGCCCCGG + Exonic
953246573 3:41199313-41199335 CCGGGCCGGGGTGGGGTGCCTGG - Intronic
954421217 3:50420008-50420030 CCGCGTCTCCGCGGGGGACCTGG - Intronic
954912814 3:54122782-54122804 CTACGCCGCGCTGGGGGACGTGG + Exonic
954955165 3:54512454-54512476 CCATGCCACTGTGGGGGACCCGG - Intronic
955239049 3:57164242-57164264 CCGGGCCTCGGTGGGAGACTCGG + Intronic
971257882 4:25030719-25030741 CGGCGCGGCGGTGGGGGTCGGGG - Exonic
983923514 4:173371528-173371550 CCGCCCCTCGGTGGGGCCCCAGG + Intronic
985591430 5:767324-767346 CTGCGCCCTGGTGTGGGACCCGG - Intergenic
986608427 5:9545497-9545519 CCGCGCCGCTGGCCGGGACCCGG - Intronic
986695930 5:10354108-10354130 CCGCGCCGCCGAGGGGGGCGGGG + Intronic
987035157 5:14011843-14011865 CCGCGCCGCGCTGGGGGCGGTGG - Intergenic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
997303435 5:132822850-132822872 CCGCGCCGGGCTGGGAGACGGGG + Exonic
1002080265 5:176733421-176733443 CCGCGCAGGAGTGGGGGACAAGG - Intergenic
1002163684 5:177332127-177332149 CTGCGCCGTGGTGGGGGCCGTGG - Exonic
1002692425 5:181059550-181059572 GCGCGACGCGGTGCGGGGCCAGG - Exonic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1006170152 6:32087761-32087783 CCGCGGCACGGTGCAGGACCTGG - Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1007432847 6:41786538-41786560 CCGCGCCGCGGTCGGGGTTGCGG + Intronic
1009437539 6:63635714-63635736 CCGCGCCTCCGTGGGGCCCCGGG - Intergenic
1019343606 7:519585-519607 GCGCGCCGCGGAGGGGGTGCTGG - Intronic
1019414537 7:921207-921229 CGGCGCCGAGGTGGGGGCACTGG - Intronic
1019483093 7:1275223-1275245 CCGCCCCACGGTGGGGGAGGCGG - Intergenic
1019536174 7:1530929-1530951 CCGCGGCGGGGACGGGGACCGGG + Intronic
1020660380 7:10974242-10974264 CAGCGCCGAGGTCGGGGACTGGG - Exonic
1020796859 7:12687049-12687071 CCGCGGCGGGGTGGGCGGCCGGG + Intronic
1030176382 7:106660013-106660035 CCGCGCCGCGGCCCGGGACAGGG + Exonic
1033253329 7:139778197-139778219 CCGCGCAGCGCGGGGGGACTGGG + Intronic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1037143035 8:15540421-15540443 CCCTGCCGCGATGGGGGCCCGGG + Exonic
1047739335 8:127794385-127794407 CCGGGCGGCGGGCGGGGACCTGG + Intergenic
1049574509 8:143384090-143384112 CTGAGCCGGGGTGGGGGTCCAGG + Exonic
1049643739 8:143727007-143727029 CTGCGCCGCGGTGAGCGACGCGG + Exonic
1049647000 8:143739966-143739988 CCGCGCCGCTGTGGGTGACCGGG + Intergenic
1054731351 9:68705334-68705356 CCGCGGCGCGTTCGGGGACCGGG - Intergenic
1057207850 9:93184263-93184285 CCGCGCTGGGGTGGGGGCCGTGG - Intergenic
1057488605 9:95506022-95506044 CCGGGCCGCGGAGCGGGGCCGGG + Intronic
1060106802 9:120877491-120877513 CCGCTCCTCGGCGGGGGGCCCGG - Intronic
1060700506 9:125746651-125746673 CCGCGCCGGGGGGAGGGACGGGG - Intergenic
1061656978 9:132099796-132099818 CTCCGCCTCCGTGGGGGACCAGG + Intergenic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062153267 9:135032332-135032354 CCCCGCCCTGGTCGGGGACCTGG + Intergenic
1062357164 9:136170471-136170493 CCGCCCAGCGATGGGGGACCCGG + Intergenic
1062364630 9:136202933-136202955 CTGCGCCGAGGTGGGTGCCCGGG - Exonic
1062574499 9:137200063-137200085 CCGCGCCGCGGTGCAGACCCCGG + Exonic
1062596489 9:137302123-137302145 CCGCGCCCGGGTGGGCGACGGGG + Exonic
1203469649 Un_GL000220v1:111009-111031 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic
1203477470 Un_GL000220v1:154981-155003 CCGCGTCGCGGTGGGGGGGTGGG - Intergenic