ID: 1064764762

View in Genome Browser
Species Human (GRCh38)
Location 10:18659564-18659586
Sequence CCGCGCCGCGGTGGGGGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064764749_1064764762 22 Left 1064764749 10:18659519-18659541 CCTCGCTGCGCGATCTCAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764753_1064764762 -6 Left 1064764753 10:18659547-18659569 CCTCGGCTCCGCGCAGCCCGCGC 0: 1
1: 0
2: 3
3: 41
4: 356
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151
1064764748_1064764762 23 Left 1064764748 10:18659518-18659540 CCCTCGCTGCGCGATCTCAGGCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064764762 Original CRISPR CCGCGCCGCGGTGGGGGACC CGG Exonic