ID: 1064767030

View in Genome Browser
Species Human (GRCh38)
Location 10:18685505-18685527
Sequence GGAGTCTCATCTAGAAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064767030_1064767036 28 Left 1064767030 10:18685505-18685527 CCTACATTTCTAGATGAGACTCC No data
Right 1064767036 10:18685556-18685578 TTGTGGTGCACTCTCTTAATGGG No data
1064767030_1064767033 11 Left 1064767030 10:18685505-18685527 CCTACATTTCTAGATGAGACTCC No data
Right 1064767033 10:18685539-18685561 CCTACCAGTAAGACAAATTGTGG No data
1064767030_1064767035 27 Left 1064767030 10:18685505-18685527 CCTACATTTCTAGATGAGACTCC No data
Right 1064767035 10:18685555-18685577 ATTGTGGTGCACTCTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064767030 Original CRISPR GGAGTCTCATCTAGAAATGT AGG (reversed) Intergenic