ID: 1064767030 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:18685505-18685527 |
| Sequence | GGAGTCTCATCTAGAAATGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064767030_1064767036 | 28 | Left | 1064767030 | 10:18685505-18685527 | CCTACATTTCTAGATGAGACTCC | No data | ||
| Right | 1064767036 | 10:18685556-18685578 | TTGTGGTGCACTCTCTTAATGGG | No data | ||||
| 1064767030_1064767033 | 11 | Left | 1064767030 | 10:18685505-18685527 | CCTACATTTCTAGATGAGACTCC | No data | ||
| Right | 1064767033 | 10:18685539-18685561 | CCTACCAGTAAGACAAATTGTGG | No data | ||||
| 1064767030_1064767035 | 27 | Left | 1064767030 | 10:18685505-18685527 | CCTACATTTCTAGATGAGACTCC | No data | ||
| Right | 1064767035 | 10:18685555-18685577 | ATTGTGGTGCACTCTCTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064767030 | Original CRISPR | GGAGTCTCATCTAGAAATGT AGG (reversed) | Intergenic | ||