ID: 1064769572

View in Genome Browser
Species Human (GRCh38)
Location 10:18710420-18710442
Sequence CCGCCTGCACGCCCGGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064769572_1064769588 6 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769588 10:18710449-18710471 AGGGGTGGTCGCGGAGGAAGGGG No data
1064769572_1064769590 13 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769590 10:18710456-18710478 GTCGCGGAGGAAGGGGGCACAGG No data
1064769572_1064769591 22 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769591 10:18710465-18710487 GAAGGGGGCACAGGTATACCTGG No data
1064769572_1064769589 7 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769589 10:18710450-18710472 GGGGTGGTCGCGGAGGAAGGGGG No data
1064769572_1064769586 4 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769586 10:18710447-18710469 GGAGGGGTGGTCGCGGAGGAAGG No data
1064769572_1064769585 0 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769585 10:18710443-18710465 GTTTGGAGGGGTGGTCGCGGAGG No data
1064769572_1064769584 -3 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769584 10:18710440-18710462 CGGGTTTGGAGGGGTGGTCGCGG No data
1064769572_1064769583 -9 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769583 10:18710434-18710456 TGCAGGCGGGTTTGGAGGGGTGG No data
1064769572_1064769587 5 Left 1064769572 10:18710420-18710442 CCCCTACCCGGGCGTGCAGGCGG No data
Right 1064769587 10:18710448-18710470 GAGGGGTGGTCGCGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064769572 Original CRISPR CCGCCTGCACGCCCGGGTAG GGG (reversed) Intergenic
No off target data available for this crispr