ID: 1064771028 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:18722981-18723003 |
| Sequence | CTCCACACACAGGTGGGACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064771022_1064771028 | 21 | Left | 1064771022 | 10:18722937-18722959 | CCGCGCTTGGCCTTCTGGGCAGC | No data | ||
| Right | 1064771028 | 10:18722981-18723003 | CTCCACACACAGGTGGGACAAGG | No data | ||||
| 1064771021_1064771028 | 24 | Left | 1064771021 | 10:18722934-18722956 | CCACCGCGCTTGGCCTTCTGGGC | No data | ||
| Right | 1064771028 | 10:18722981-18723003 | CTCCACACACAGGTGGGACAAGG | No data | ||||
| 1064771024_1064771028 | 11 | Left | 1064771024 | 10:18722947-18722969 | CCTTCTGGGCAGCTTTATGTGGA | No data | ||
| Right | 1064771028 | 10:18722981-18723003 | CTCCACACACAGGTGGGACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064771028 | Original CRISPR | CTCCACACACAGGTGGGACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||