ID: 1064771028

View in Genome Browser
Species Human (GRCh38)
Location 10:18722981-18723003
Sequence CTCCACACACAGGTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064771022_1064771028 21 Left 1064771022 10:18722937-18722959 CCGCGCTTGGCCTTCTGGGCAGC No data
Right 1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG No data
1064771021_1064771028 24 Left 1064771021 10:18722934-18722956 CCACCGCGCTTGGCCTTCTGGGC No data
Right 1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG No data
1064771024_1064771028 11 Left 1064771024 10:18722947-18722969 CCTTCTGGGCAGCTTTATGTGGA No data
Right 1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064771028 Original CRISPR CTCCACACACAGGTGGGACA AGG Intergenic
No off target data available for this crispr