ID: 1064771537

View in Genome Browser
Species Human (GRCh38)
Location 10:18728710-18728732
Sequence TAGCCAAGACATCTCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064771535_1064771537 3 Left 1064771535 10:18728684-18728706 CCGAAACAAATAAGCCTCTATGA No data
Right 1064771537 10:18728710-18728732 TAGCCAAGACATCTCCAAAGTGG No data
1064771534_1064771537 30 Left 1064771534 10:18728657-18728679 CCATATTCTTGGGGGCTTGACTT No data
Right 1064771537 10:18728710-18728732 TAGCCAAGACATCTCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064771537 Original CRISPR TAGCCAAGACATCTCCAAAG TGG Intergenic
No off target data available for this crispr