ID: 1064777581

View in Genome Browser
Species Human (GRCh38)
Location 10:18795933-18795955
Sequence TAATCCGAGGTGGCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064777581_1064777591 30 Left 1064777581 10:18795933-18795955 CCAGTCCCAGCCACCTCGGATTA No data
Right 1064777591 10:18795986-18796008 CCTTGGTTGTCTCCAAGCATTGG No data
1064777581_1064777587 -2 Left 1064777581 10:18795933-18795955 CCAGTCCCAGCCACCTCGGATTA No data
Right 1064777587 10:18795954-18795976 TAGAGCACACAGACCAGGAGTGG No data
1064777581_1064777589 13 Left 1064777581 10:18795933-18795955 CCAGTCCCAGCCACCTCGGATTA No data
Right 1064777589 10:18795969-18795991 AGGAGTGGAGAGCTGAGCCTTGG No data
1064777581_1064777586 -7 Left 1064777581 10:18795933-18795955 CCAGTCCCAGCCACCTCGGATTA No data
Right 1064777586 10:18795949-18795971 CGGATTAGAGCACACAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064777581 Original CRISPR TAATCCGAGGTGGCTGGGAC TGG (reversed) Intergenic
No off target data available for this crispr