ID: 1064780780

View in Genome Browser
Species Human (GRCh38)
Location 10:18835916-18835938
Sequence TCCTTCTCAGGTTAAATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064780775_1064780780 6 Left 1064780775 10:18835887-18835909 CCAACGACTGATAAATATACCAT No data
Right 1064780780 10:18835916-18835938 TCCTTCTCAGGTTAAATCTAGGG No data
1064780774_1064780780 10 Left 1064780774 10:18835883-18835905 CCAACCAACGACTGATAAATATA No data
Right 1064780780 10:18835916-18835938 TCCTTCTCAGGTTAAATCTAGGG No data
1064780773_1064780780 11 Left 1064780773 10:18835882-18835904 CCCAACCAACGACTGATAAATAT No data
Right 1064780780 10:18835916-18835938 TCCTTCTCAGGTTAAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064780780 Original CRISPR TCCTTCTCAGGTTAAATCTA GGG Intergenic
No off target data available for this crispr