ID: 1064782368

View in Genome Browser
Species Human (GRCh38)
Location 10:18856671-18856693
Sequence CCCAGCAGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 5, 2: 12, 3: 24, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064782364_1064782368 -9 Left 1064782364 10:18856657-18856679 CCAGCTCCTCATCACCCAGCAGG No data
Right 1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG 0: 2
1: 5
2: 12
3: 24
4: 118
1064782360_1064782368 26 Left 1064782360 10:18856622-18856644 CCTTCTCTTCTGTATACTCATCT No data
Right 1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG 0: 2
1: 5
2: 12
3: 24
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064782368 Original CRISPR CCCAGCAGGTACCCCGAGTC CGG Intergenic
900469861 1:2848415-2848437 CCCAGGAGGTACCCAGAGAGGGG + Intergenic
900772237 1:4554419-4554441 GCCAGCAGGGTCCCCGAGGCTGG - Intergenic
902637613 1:17744868-17744890 CCCAGGAGGGACACCGAGGCCGG + Intergenic
904007434 1:27370813-27370835 CCCAGCAGGGTCCTGGAGTCTGG - Intronic
904811065 1:33163769-33163791 CGCAGCAGGAAAGCCGAGTCAGG + Intronic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
906691074 1:47793041-47793063 CCCAGCAGGTGCCCTGCGGCTGG + Intronic
907389039 1:54144585-54144607 CCCAGCAGGTTGCCCTTGTCTGG + Exonic
910100269 1:83568277-83568299 CCCCGCAGATACCCTGACTCTGG + Intergenic
911700992 1:100951601-100951623 CACAGCAGTTACCACGAGCCTGG - Intronic
912723100 1:112036345-112036367 ACCAGCAGGTACCCACAGGCAGG + Intergenic
913307814 1:117450942-117450964 CCCAGCAGGTACTCTGTGTTGGG - Intronic
913402822 1:118455035-118455057 CCCAGCAGGGACCCAGTGTGGGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
922238015 1:223736145-223736167 GCCAGCAGGGACCCCGCCTCTGG + Intronic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1062818933 10:519559-519581 CCCAGCTGGCACCACGAGCCTGG + Intronic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1065534247 10:26701738-26701760 CCCAGCAGGGACTCCGTGTGGGG - Intronic
1071447505 10:85762470-85762492 CCCAGCTGGCACCCCCAGACAGG - Intronic
1074703979 10:116115398-116115420 CCTGGCAGGTTCCCAGAGTCAGG + Intronic
1075072569 10:119328480-119328502 CCCAGCAAGTACCCCCTTTCTGG + Intronic
1075467248 10:122660993-122661015 CCCAGCAGGTACCCAGCAACTGG - Intergenic
1075475084 10:122727496-122727518 CCCAGCAGGGATCCTGAGTGTGG - Intergenic
1077098449 11:810053-810075 CCCAGCCGGCACCCCGGGCCCGG - Intronic
1080665233 11:34330113-34330135 CCCAGCAGGGACCAGAAGTCAGG - Intronic
1081671831 11:44946836-44946858 CCCAGCAGGGACCTGGAGTGTGG - Intronic
1083547274 11:63558316-63558338 CCCAGCAGGGACCCAGCCTCTGG + Intronic
1083764761 11:64836465-64836487 CCCAGCTGGTAGCCCAGGTCAGG - Exonic
1084166354 11:67376437-67376459 CCCAGCAGCTACCCCCATTTAGG - Intronic
1085346779 11:75773277-75773299 CCCTGGAGGTACCCACAGTCTGG + Intronic
1091282530 11:134390175-134390197 CCCAGCAGGCATCCCGTGTGGGG - Exonic
1091624877 12:2114168-2114190 CCCAGGAGAGACCCCAAGTCAGG - Intronic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1101493242 12:105229667-105229689 CCCAGCAGGAACCAGCAGTCTGG + Intronic
1106754742 13:32811261-32811283 CCCTGCAGGTCCCCCAGGTCAGG + Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1107959833 13:45548030-45548052 CCCACCAGGGACCCTGAGTTTGG + Intronic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG + Intronic
1113144434 13:107192232-107192254 CACAGCTGGTGCCCCGTGTCAGG - Intronic
1113885854 13:113658053-113658075 CCCAGCATCTGCCCCGTGTCCGG + Exonic
1115812319 14:37123254-37123276 CACAGCAGGTACACCAAGCCTGG - Intronic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1118773997 14:68962108-68962130 GCTAGCAGCTTCCCCGAGTCAGG + Intronic
1122036335 14:98951744-98951766 CCCTGCAGGTAACCTGAGTGAGG + Intergenic
1122613945 14:103004085-103004107 CCCAGGAGGGACCCCGAGACCGG - Intronic
1128688807 15:69707602-69707624 CCCAGTAGGGACTCCGTGTCGGG + Intergenic
1129670929 15:77607368-77607390 CCCAGCAGGGACCCAAGGTCTGG - Intergenic
1132604137 16:786647-786669 GCCAGCAGGGACCCTGTGTCAGG + Intronic
1132893048 16:2214039-2214061 CCCCGCAGGTACCGGGTGTCTGG - Exonic
1133946855 16:10355926-10355948 CCCAGTAGCCTCCCCGAGTCTGG - Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1142638387 17:1271272-1271294 CCCAGCCGGTGCCTCGAGGCCGG - Exonic
1144667374 17:17111378-17111400 CCCAGCAGGTGTCCTGAGGCAGG + Intronic
1144761374 17:17709456-17709478 CCCAGCAGGGAGGCCGAGGCAGG - Intronic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG + Intergenic
1148772197 17:50073997-50074019 CCCAGCAGGTACAGAGAGACGGG + Exonic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1160990569 19:1858754-1858776 ACCCCCAGGTACCCAGAGTCTGG - Intronic
1161816120 19:6501256-6501278 CCCAGCAGGGAGCCAGAGGCTGG - Intronic
1162805690 19:13137012-13137034 CACAGCAGGCACCCCGAGGATGG + Intronic
1163636069 19:18437701-18437723 CCCGGCAGGTGCCCCGGCTCGGG - Exonic
1163766246 19:19165041-19165063 GCCAGCAGGGACCCCGAGATGGG + Intronic
1164609490 19:29622423-29622445 CCCAGCAGGAAACCCGAGTCAGG + Intergenic
927155204 2:20217342-20217364 CACAGCAGGTACCCAGGATCTGG + Intronic
927409251 2:22806048-22806070 CCCAGTAGGGACCCTGTGTCAGG + Intergenic
927886809 2:26723878-26723900 CCCAGCAGGTACTGCGAGAGAGG + Intronic
932042941 2:68319384-68319406 CCCGGCAGGTCCCCCATGTCTGG + Exonic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
944897239 2:204177760-204177782 CCCAGCAGGCAGCCCGAGGGAGG - Intergenic
948335597 2:237204726-237204748 CCCACCAGCTACCCCGGGTCAGG + Intergenic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1170738105 20:19028031-19028053 CCCAACAGGCAGCCCGGGTCGGG + Intergenic
1175761907 20:61566968-61566990 CCCATCAGCTCCCCCGAGGCAGG - Intronic
1176300979 21:5098967-5098989 CGGAGCAGGAACCCAGAGTCAGG - Intergenic
1179174107 21:38995012-38995034 CCCTGCATGGACCCAGAGTCCGG - Intergenic
1179457235 21:41508035-41508057 CCCAGCCCGGACCCCGAGCCGGG + Exonic
1179856049 21:44162931-44162953 CGGAGCAGGAACCCAGAGTCAGG + Intergenic
1179979100 21:44887252-44887274 TCCAGCAGGGACCCTGAGCCTGG - Intronic
1180160279 21:45996057-45996079 CCCAGGAGGTGCCCCCAGTGAGG + Intronic
1181547874 22:23613553-23613575 CCCAGCAGGACCCCAGAATCAGG + Intronic
1181600598 22:23949700-23949722 CTCACCAGGAGCCCCGAGTCCGG - Intergenic
1181607913 22:23991622-23991644 CTCACCAGGAGCCCCGAGTCCGG + Intergenic
1182621522 22:31621187-31621209 CCCAGCACGGAGCCCGAGTGTGG + Intronic
1183698168 22:39434929-39434951 CACAGCAGGTACCCGGAGGTAGG - Intronic
1184550628 22:45202593-45202615 CCCAGCAGGTCCACCCAGGCAGG + Intronic
1184749680 22:46478113-46478135 CTCAGCAGGTACCAGGAGCCCGG + Intronic
949731414 3:7117541-7117563 CCCAGGAGGGCCCCAGAGTCAGG - Intronic
950193143 3:10992030-10992052 CCCAGCTGGTACCCAGAGCCTGG + Intergenic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
951093058 3:18597851-18597873 CCCAGCAGGGACCCTGTGTGGGG + Intergenic
952716403 3:36484801-36484823 CCCAGCAGGGACACAGAGGCAGG - Intronic
954323446 3:49847771-49847793 TCCTGCAGGTACCCCAAGTTGGG + Intronic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
962267397 3:133953710-133953732 CCCAGCAGGTACCCGAAAGCCGG + Exonic
967902111 3:194465246-194465268 CCCAGCAGTTTCCCTGAGTTTGG + Intronic
969256082 4:6002683-6002705 ACCAGCAGCGACCCTGAGTCAGG - Intergenic
969282425 4:6179627-6179649 CCCAGCAGTGGCCCTGAGTCAGG + Intronic
975623299 4:76315811-76315833 CCCAGCACCAGCCCCGAGTCTGG + Intronic
975706368 4:77115948-77115970 CGCAGCAGGGACCCCCAGTGAGG + Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
977789691 4:101084923-101084945 CCCATCTGGTACCCAGAATCAGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
987723065 5:21663430-21663452 CCCAGCAGGGACTCCATGTCAGG + Intergenic
988564113 5:32307339-32307361 CCCAGCAGGTCCCCCGACAGAGG + Intronic
990500293 5:56389905-56389927 ACCAGCAGGTCCCCCAGGTCTGG + Intergenic
991559565 5:67935128-67935150 CCCAGCAGGGATCCCGAGGATGG - Intergenic
1006099934 6:31680334-31680356 CCCTGCAGGGAGCCAGAGTCTGG - Exonic
1007252024 6:40502278-40502300 CCCAGCCGGCACCCAGAGCCAGG + Intronic
1012996539 6:105981253-105981275 CCGGGCAGGGACCCCGAATCCGG + Intergenic
1014792700 6:125692930-125692952 CCCAGCAGCAACCCAGAGCCTGG - Intergenic
1019292192 7:256252-256274 CCCACCAGGTCCCTCGAATCGGG + Intronic
1019435750 7:1021260-1021282 CCCAGCAGGGACCTCTAGTGTGG + Intronic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1022617134 7:31943090-31943112 ACCAGGAGGTACCCCTAGTATGG - Intronic
1024230760 7:47361466-47361488 CCCAGCACGTTCCCCAACTCTGG + Intronic
1025236647 7:57239273-57239295 CCCAGCAGCTTCCCCGGGCCAGG - Intergenic
1027250888 7:76397973-76397995 CCCACAAGCTACCCCCAGTCTGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1029406129 7:100374903-100374925 CCCAGCAGGTGCCCAGTGGCTGG + Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1034876917 7:154732903-154732925 CCCAGCAGCTACTCCTTGTCAGG - Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1041260757 8:56019026-56019048 CCCAGCAGGTAAGCAGATTCAGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1049449885 8:142654945-142654967 CTCAGAAGGGACCCCGAGGCTGG - Intergenic
1052701356 9:31941578-31941600 CCCAGCAGGGACTCTGTGTCGGG - Intergenic
1057128593 9:92638067-92638089 CCGGGCAGGCACCCTGAGTCCGG - Exonic
1057953169 9:99386006-99386028 CCCAGCAGGGAGCCAGAGCCTGG - Intergenic
1061480496 9:130895654-130895676 CCCAGCAGGAACCCCAGCTCAGG - Intergenic
1061538381 9:131263854-131263876 GCCTGCAGGTTCCCTGAGTCTGG - Intronic
1061895732 9:133646406-133646428 CCCAGCCGGTACTCAGAGCCTGG + Intronic
1185468939 X:371193-371215 CCCAGCATGTACCTGGAGTGGGG - Intronic
1198731769 X:139738672-139738694 TCCAGCAGGAACCCCCATTCTGG + Intronic
1199011837 X:142767892-142767914 CCCAACAGGTACCCCGCATCTGG + Intergenic
1200080461 X:153573639-153573661 CCCATCAGGCACTCCGAGTGTGG + Intronic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201783927 Y:17752884-17752906 CCCGGCAGGTACTTTGAGTCTGG + Intergenic
1201817626 Y:18153103-18153125 CCCGGCAGGTACTTTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201863228 Y:18622551-18622573 CCTAGCACGTACCCTGAGTCTGG + Intergenic
1201870094 Y:18697827-18697849 CCTAGCACGTACCCTGAGTCTGG - Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic