ID: 1064783447

View in Genome Browser
Species Human (GRCh38)
Location 10:18868012-18868034
Sequence AGCACTGAGGTCCCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064783447_1064783455 9 Left 1064783447 10:18868012-18868034 CCATTTGCAGGGACCTCAGTGCT No data
Right 1064783455 10:18868044-18868066 GGGTCTGGTTCTGATTCAGCTGG No data
1064783447_1064783456 21 Left 1064783447 10:18868012-18868034 CCATTTGCAGGGACCTCAGTGCT No data
Right 1064783456 10:18868056-18868078 GATTCAGCTGGACCTCTCCATGG No data
1064783447_1064783454 -6 Left 1064783447 10:18868012-18868034 CCATTTGCAGGGACCTCAGTGCT No data
Right 1064783454 10:18868029-18868051 AGTGCTGTGGGTTAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064783447 Original CRISPR AGCACTGAGGTCCCTGCAAA TGG (reversed) Intergenic
No off target data available for this crispr