ID: 1064783454

View in Genome Browser
Species Human (GRCh38)
Location 10:18868029-18868051
Sequence AGTGCTGTGGGTTAGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064783447_1064783454 -6 Left 1064783447 10:18868012-18868034 CCATTTGCAGGGACCTCAGTGCT No data
Right 1064783454 10:18868029-18868051 AGTGCTGTGGGTTAGGGGTCTGG No data
1064783442_1064783454 26 Left 1064783442 10:18867980-18868002 CCATTTTTAAGATGCTAGCAAAT No data
Right 1064783454 10:18868029-18868051 AGTGCTGTGGGTTAGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064783454 Original CRISPR AGTGCTGTGGGTTAGGGGTC TGG Intergenic
No off target data available for this crispr