ID: 1064783455

View in Genome Browser
Species Human (GRCh38)
Location 10:18868044-18868066
Sequence GGGTCTGGTTCTGATTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064783453_1064783455 -4 Left 1064783453 10:18868025-18868047 CCTCAGTGCTGTGGGTTAGGGGT No data
Right 1064783455 10:18868044-18868066 GGGTCTGGTTCTGATTCAGCTGG No data
1064783447_1064783455 9 Left 1064783447 10:18868012-18868034 CCATTTGCAGGGACCTCAGTGCT No data
Right 1064783455 10:18868044-18868066 GGGTCTGGTTCTGATTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064783455 Original CRISPR GGGTCTGGTTCTGATTCAGC TGG Intergenic
No off target data available for this crispr