ID: 1064790142

View in Genome Browser
Species Human (GRCh38)
Location 10:18949830-18949852
Sequence CCACCATGCCTGGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064790139_1064790142 4 Left 1064790139 10:18949803-18949825 CCAAAGTGCTGGAATTATAGACA 0: 32
1: 1472
2: 22697
3: 138171
4: 262217
Right 1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
1064790134_1064790142 18 Left 1064790134 10:18949789-18949811 CCCACCTCAGCCTTCCAAAGTGC 0: 1159
1: 36363
2: 141169
3: 238172
4: 235505
Right 1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
1064790135_1064790142 17 Left 1064790135 10:18949790-18949812 CCACCTCAGCCTTCCAAAGTGCT 0: 2041
1: 65801
2: 152431
3: 156620
4: 112039
Right 1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
1064790138_1064790142 8 Left 1064790138 10:18949799-18949821 CCTTCCAAAGTGCTGGAATTATA 0: 55
1: 3110
2: 52695
3: 348805
4: 247216
Right 1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
1064790137_1064790142 14 Left 1064790137 10:18949793-18949815 CCTCAGCCTTCCAAAGTGCTGGA 0: 156
1: 7716
2: 104190
3: 224339
4: 246795
Right 1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064790142 Original CRISPR CCACCATGCCTGGCCAAAAC AGG Intergenic
Too many off-targets to display for this crispr