ID: 1064793236

View in Genome Browser
Species Human (GRCh38)
Location 10:18982925-18982947
Sequence TTATGTCCCCAAAGGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064793236_1064793241 14 Left 1064793236 10:18982925-18982947 CCAAGTTCCCTTTGGGGACATAA No data
Right 1064793241 10:18982962-18982984 AGATACAATCTAATTGCAGTAGG No data
1064793236_1064793243 16 Left 1064793236 10:18982925-18982947 CCAAGTTCCCTTTGGGGACATAA No data
Right 1064793243 10:18982964-18982986 ATACAATCTAATTGCAGTAGGGG No data
1064793236_1064793242 15 Left 1064793236 10:18982925-18982947 CCAAGTTCCCTTTGGGGACATAA No data
Right 1064793242 10:18982963-18982985 GATACAATCTAATTGCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064793236 Original CRISPR TTATGTCCCCAAAGGGAACT TGG (reversed) Intergenic
No off target data available for this crispr