ID: 1064803504

View in Genome Browser
Species Human (GRCh38)
Location 10:19103625-19103647
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064803499_1064803504 17 Left 1064803499 10:19103585-19103607 CCAAAGGGGAAGATGGGACACAA 0: 1
1: 1
2: 2
3: 22
4: 206
Right 1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr