ID: 1064804825

View in Genome Browser
Species Human (GRCh38)
Location 10:19119032-19119054
Sequence ACTACTACCAACTCTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064804825_1064804830 9 Left 1064804825 10:19119032-19119054 CCTGAGCCAGAGTTGGTAGTAGT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG No data
1064804825_1064804829 2 Left 1064804825 10:19119032-19119054 CCTGAGCCAGAGTTGGTAGTAGT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1064804829 10:19119057-19119079 TGGAGGTCATAAGATGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064804825 Original CRISPR ACTACTACCAACTCTGGCTC AGG (reversed) Intronic
900103301 1:971889-971911 GCTACCACCAACCCTGGCGCGGG - Intronic
900998849 1:6137394-6137416 ACCACGACCAGCCCTGGCTCTGG + Intronic
902388359 1:16088728-16088750 ACTCCTCCCAACTCTGTCCCAGG - Intergenic
905713677 1:40129575-40129597 AGCTCTACCTACTCTGGCTCTGG - Intergenic
920336876 1:205250829-205250851 ACTGCTACCAGCTCTGGCATAGG - Intronic
1064804825 10:19119032-19119054 ACTACTACCAACTCTGGCTCAGG - Intronic
1067726762 10:48776457-48776479 ACTGCTGCCACCTCTGTCTCTGG - Intronic
1068577219 10:58697957-58697979 ACTACTCCCATCACTGGCTGAGG + Intronic
1069604599 10:69731535-69731557 ATCACTACCACCACTGGCTCTGG - Intergenic
1070955613 10:80461499-80461521 ACTACCACCAACTCTGATTTTGG - Intronic
1074819305 10:117166772-117166794 ACTCCAACCCACTCTGGCTCCGG - Intergenic
1075981629 10:126745519-126745541 CCTACCCCCAACTCTGCCTCTGG - Intergenic
1081765319 11:45606353-45606375 TCTCCCACCAACTCTGACTCAGG - Intergenic
1082050081 11:47763799-47763821 ACTGCTAAAAACTATGGCTCTGG - Intronic
1086420944 11:86636458-86636480 ACTGCAACCAACACTGGTTCAGG + Intronic
1093342216 12:17991952-17991974 AATACCAGCAACTCTGGCTAGGG + Intergenic
1095425554 12:42071196-42071218 GCTACTGCCAGCTCTGCCTCCGG + Intergenic
1095714123 12:45323034-45323056 CCTCCTACCTTCTCTGGCTCTGG + Intronic
1096274333 12:50192712-50192734 AACACTAACAACTATGGCTCAGG + Intronic
1096760037 12:53833845-53833867 ACTACTGACAAATCTGGCTGAGG + Intergenic
1117709576 14:58511569-58511591 ACTAGGACTACCTCTGGCTCTGG - Intronic
1122882606 14:104696841-104696863 CCCACCACCAACGCTGGCTCAGG + Intronic
1129681591 15:77661390-77661412 GCTACTCCCAGCTCTGCCTCAGG + Intronic
1130217676 15:81987481-81987503 ACTACCACGAATTCTGGCTAGGG + Intergenic
1134808454 16:17145940-17145962 ACTACAACACACTTTGGCTCTGG + Intronic
1135344726 16:21679476-21679498 ACTACTGCAACCTCTGCCTCCGG + Intronic
1137402095 16:48162240-48162262 CATTCTACCCACTCTGGCTCTGG - Intergenic
1138535003 16:57655208-57655230 CCTGCTACCAGCTCTGGCTGGGG - Intronic
1140833572 16:78773275-78773297 TCTACTACAACTTCTGGCTCTGG + Intronic
1141484462 16:84329654-84329676 ATTCCTCCCAAGTCTGGCTCTGG + Exonic
1141704680 16:85658287-85658309 ATTCCCACCAACTCTGGCTGAGG - Intronic
1156285293 18:35687982-35688004 ACTACTAAGAACTCAGGCTAAGG - Intronic
1157290837 18:46408356-46408378 CCTAAGGCCAACTCTGGCTCTGG - Intronic
1161499652 19:4606920-4606942 TGTGCTACCACCTCTGGCTCTGG + Intergenic
926536984 2:14125232-14125254 ACAGCTACAAAGTCTGGCTCTGG - Intergenic
928006953 2:27571155-27571177 ACATCTTCCAATTCTGGCTCTGG - Intergenic
929688174 2:44052361-44052383 ACTACTACCCACCCTGACACTGG - Intergenic
933456444 2:82525544-82525566 CCTAATACCAACTCTGGATTGGG + Intergenic
937032229 2:118750306-118750328 ATTACTGCCAATTCTGGCTCAGG - Intergenic
941820017 2:169835249-169835271 AATACTCCCAACTCAGCCTCGGG - Intronic
942073126 2:172333108-172333130 TCTACTACCATCTCTTGCTCTGG - Intergenic
944821081 2:203431964-203431986 AATACCACCAACTCTCCCTCTGG - Exonic
946466354 2:219915326-219915348 ACTACTAAAAGCTCTGTCTCTGG + Intergenic
1170577050 20:17672031-17672053 ACTACTACCAACTCTGGACCTGG + Intronic
1181333439 22:22112256-22112278 CCTGGGACCAACTCTGGCTCAGG + Intergenic
1183200570 22:36383264-36383286 CTTACTTCCAACTCTGGCTCTGG - Intronic
949346596 3:3082714-3082736 ACTAGTCCCAGCTCTGCCTCTGG + Intronic
953885459 3:46712342-46712364 CCTCCTACCAACACTGGATCTGG - Exonic
954045633 3:47927420-47927442 CTTCCTACCAACTCTAGCTCTGG + Intronic
955603074 3:60668904-60668926 ACAACTACCAACTCTGGTAATGG - Intronic
959584594 3:108014366-108014388 CTTACTACAAACTCTGGCTCCGG + Intergenic
960197679 3:114790045-114790067 ACTAGTACCAACTACAGCTCAGG + Intronic
960788532 3:121400369-121400391 AGTACTACCAACTCAGGATAAGG - Intronic
964805970 3:160610293-160610315 GCTACTACAAGCTCTGCCTCCGG + Intergenic
967767903 3:193302232-193302254 ACTACTAACCACTTTGTCTCAGG + Intronic
968927931 4:3559803-3559825 GCTACAACCAACCCAGGCTCGGG - Intergenic
969111504 4:4847156-4847178 ACTTCTACCAACTCAGCCTTTGG - Intergenic
970960644 4:21867438-21867460 ACTACTACATTCTCTGTCTCTGG + Intronic
978845190 4:113264985-113265007 ACCAGTACCTACCCTGGCTCTGG - Exonic
981895696 4:149796283-149796305 ACCACTACCACCTCAGGCACAGG - Intergenic
985429184 4:189861726-189861748 ATTACTACCAAGTGTGACTCTGG - Intergenic
996800738 5:127400019-127400041 TCTACTACCAGGTCTGGCTGTGG - Intronic
1001359976 5:171073514-171073536 ACTAGAATGAACTCTGGCTCTGG + Intronic
1004146911 6:13076441-13076463 ACACCTAGCAACACTGGCTCTGG + Intronic
1004583705 6:16979127-16979149 AGTGCTAATAACTCTGGCTCTGG + Intergenic
1004652643 6:17625840-17625862 AATACTACCACCTCTGGTTTCGG - Exonic
1004932583 6:20476466-20476488 ACCACTCAAAACTCTGGCTCTGG - Intronic
1007660141 6:43479160-43479182 GCTACTCCCAACTCTGGCTAGGG - Intronic
1011962341 6:93106515-93106537 ACTACTGCCAGGCCTGGCTCAGG + Intergenic
1012034371 6:94113246-94113268 ACTATTACCAACACTTACTCAGG + Intergenic
1013556223 6:111259626-111259648 ACCACCACCACCTCCGGCTCCGG - Exonic
1017300671 6:152854237-152854259 AGAACAACCAACTCTGCCTCAGG - Intergenic
1018914976 6:168127599-168127621 ACAAATGCCAACGCTGGCTCTGG + Intergenic
1020460666 7:8426199-8426221 ACGACCACCAACTCTGGACCTGG - Intergenic
1021944594 7:25714333-25714355 ACGACTCCCTACTCTGTCTCCGG + Intergenic
1023078909 7:36509420-36509442 ATTAGAACCAACTCTGGATCTGG - Intergenic
1030418605 7:109277977-109277999 ATTATTATCAACTCTGGTTCTGG + Intergenic
1031549834 7:123095374-123095396 ACTGCTACCAACTCTTACTGAGG - Intergenic
1031916107 7:127564462-127564484 ACAACTCCCAAATCTGTCTCTGG + Intergenic
1037842227 8:22253254-22253276 ACTACTGTCCACTCTGGCTGTGG - Exonic
1042797880 8:72684426-72684448 ACTCCTACCCACTCTGCCCCTGG - Intronic
1047293776 8:123553022-123553044 ACAGAAACCAACTCTGGCTCGGG - Intergenic
1056308172 9:85312011-85312033 ACTACTACAAAGTGTGGCCCTGG + Intergenic
1059735518 9:117095999-117096021 CCTTCTACAAACTCTGGTTCTGG + Intronic
1061447803 9:130651132-130651154 CTTACTACCTTCTCTGGCTCAGG - Intergenic
1187719790 X:22138612-22138634 ACTAATCCCAACTCTGCATCTGG + Intronic
1190322915 X:49188878-49188900 ACTCCTCCCAACTCTGGCCTTGG - Exonic
1196689596 X:118545009-118545031 ACCACTAACAGCTCTGGCACAGG + Intronic