ID: 1064804827

View in Genome Browser
Species Human (GRCh38)
Location 10:19119038-19119060
Sequence TCCACTACTACTACCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064804827_1064804830 3 Left 1064804827 10:19119038-19119060 CCAGAGTTGGTAGTAGTAGTGGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG No data
1064804827_1064804829 -4 Left 1064804827 10:19119038-19119060 CCAGAGTTGGTAGTAGTAGTGGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1064804829 10:19119057-19119079 TGGAGGTCATAAGATGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064804827 Original CRISPR TCCACTACTACTACCAACTC TGG (reversed) Intronic
905148439 1:35906681-35906703 TCCTCTAGTCCTACCTACTCAGG + Intronic
906795963 1:48696578-48696600 ACCACTACTACCACCACCTGTGG + Intronic
910215826 1:84843279-84843301 TACACTACTACCCCCTACTCAGG - Intronic
911208231 1:95114267-95114289 TACACTAAAACTACCAACACAGG + Intergenic
915930977 1:160060927-160060949 CCCACTCCTGCTACGAACTCTGG - Intronic
917597996 1:176549026-176549048 GCTAATACTACTACCATCTCAGG + Intronic
917862179 1:179157068-179157090 TCCACCACCACTACCAATACAGG + Intronic
919073308 1:192783412-192783434 ACCAGTTCTATTACCAACTCTGG - Intergenic
922556786 1:226538644-226538666 TCCACTATTACTGCAGACTCAGG - Intergenic
1064489265 10:15833148-15833170 TCCACTACCACTTCCATTTCTGG - Intronic
1064804827 10:19119038-19119060 TCCACTACTACTACCAACTCTGG - Intronic
1073347843 10:102798072-102798094 GCAACTACTACTATGAACTCTGG + Exonic
1075180518 10:120206952-120206974 TCCACTGCTACCATCATCTCAGG + Intergenic
1077948889 11:6933026-6933048 TCTGCTACAAGTACCAACTCTGG - Intronic
1078780968 11:14439147-14439169 ACCACCACTACTACCAATTTTGG - Intergenic
1079069194 11:17328574-17328596 GCCATTACTACCACCATCTCTGG + Intronic
1080618041 11:33962033-33962055 CCCACTACCACTACCACCCCCGG + Intergenic
1080930485 11:36805072-36805094 GCCACTTCTACTAACAACTTGGG - Intergenic
1080936860 11:36872642-36872664 TCCACTAATACTATAAACTATGG - Intergenic
1087223788 11:95575597-95575619 TCCATTTCTGCTACCATCTCAGG - Intergenic
1088990194 11:114947115-114947137 TCCACCCCTAGTACCACCTCAGG + Intergenic
1092002657 12:5044671-5044693 TCCTCTACTACTACCAGTCCGGG + Exonic
1092456764 12:8650792-8650814 TCCACTTCTACTTCCAAGTAGGG - Intronic
1095519911 12:43051356-43051378 TCCACTACCCCTTCCATCTCTGG + Intergenic
1097122729 12:56748284-56748306 TACTCTTCCACTACCAACTCAGG + Intronic
1099610260 12:84858424-84858446 TCCACTACTTCTATAAACCCTGG - Intergenic
1102155786 12:110726624-110726646 ACTACTACTACTACCACCACAGG + Intronic
1102638786 12:114347879-114347901 GCCACTACTATTATCAACACTGG + Intergenic
1103031039 12:117613146-117613168 TCCTATACTGTTACCAACTCTGG - Intronic
1109058284 13:57580993-57581015 TCCCCTACTACTACCAAAGCTGG - Intergenic
1112820257 13:103325985-103326007 CCTACTACTTCTACAAACTCAGG - Intergenic
1118853668 14:69604415-69604437 TCCACTACTGCTACAGACCCTGG + Intergenic
1120411094 14:84156853-84156875 TCCTCTAGTACTAGCTACTCAGG - Intergenic
1121989059 14:98537262-98537284 CCTCCTACTACTACCACCTCAGG + Intergenic
1122846981 14:104505523-104505545 TCCCCTTCTACTACCATTTCTGG + Intronic
1127205295 15:56710455-56710477 TCAACTTCAACTACTAACTCAGG + Intronic
1127655407 15:61050993-61051015 TCCACTACTTCTGTCACCTCTGG - Intronic
1139576138 16:67843233-67843255 TCCCCTACCACCACCAACTGGGG - Exonic
1145899583 17:28481568-28481590 TTTACTCCTACTTCCAACTCAGG - Intronic
1148101247 17:45093154-45093176 TTAACTGCTACTGCCAACTCAGG - Intronic
1156285294 18:35687988-35688010 ACTACTACTACTAAGAACTCAGG - Intronic
1157787366 18:50496346-50496368 TCCAATACTACTCACAACTCTGG + Intergenic
1158229307 18:55235555-55235577 TTAACTACTACTATCGACTCTGG + Intronic
1160611231 18:80087323-80087345 TCCACTGTTTCTACCAACGCTGG - Intronic
1165475872 19:36030531-36030553 TCCCCTCCTACATCCAACTCTGG + Intronic
932412145 2:71553810-71553832 GCCACTACTACTACCTACCCTGG + Exonic
938388859 2:130888395-130888417 TTCACTGCAACCACCAACTCCGG - Intronic
940462828 2:153988886-153988908 TCCATTTTTACTACCATCTCTGG - Intronic
942889381 2:180969208-180969230 TCCACTACTACTACTGTCTTGGG + Intronic
1177043339 21:16140084-16140106 TCCACAAATTCAACCAACTCTGG - Intergenic
953439333 3:42904635-42904657 TCCCATACTACTTCCAACTTAGG + Intronic
954872575 3:53778899-53778921 TCCATTACTATTCCCAACTCAGG - Intronic
956519029 3:70083427-70083449 TCCCCGACTTCTAGCAACTCAGG + Intergenic
960788534 3:121400375-121400397 TCACCAAGTACTACCAACTCAGG - Intronic
962463749 3:135638210-135638232 TCCACTGCTACAGCCAACACTGG + Intergenic
965246203 3:166273165-166273187 TCTACTACTACTTCCAAATGAGG + Intergenic
965467245 3:169045387-169045409 CCGTCTACTACAACCAACTCAGG - Intergenic
975291015 4:72678335-72678357 TCCACCACTACTACCACAGCTGG - Intergenic
977044447 4:92051445-92051467 CCCACAACCACTACCAACCCAGG - Intergenic
979386823 4:120076612-120076634 AACACTACTATTCCCAACTCAGG - Intergenic
982473497 4:155822462-155822484 CCTACTCCTACTTCCAACTCTGG + Intergenic
982732010 4:158966057-158966079 TCCACTATGACCACCTACTCGGG - Intronic
984577898 4:181472662-181472684 TACACTCCTACTCCCAAGTCAGG - Intergenic
985042933 4:185910413-185910435 TCCATCAATACTCCCAACTCTGG + Intronic
986694601 5:10340435-10340457 TCCACGACTTCAACCAACTGTGG - Intergenic
991943853 5:71881183-71881205 TCTCCCCCTACTACCAACTCAGG - Intergenic
994106012 5:95949871-95949893 TCCATTTTTACTACCACCTCTGG + Intronic
997293233 5:132752722-132752744 ACCACTAATCCTACCATCTCAGG - Intronic
1005795621 6:29358784-29358806 TCCACTCCTACCTCAAACTCTGG - Intronic
1006255309 6:32828090-32828112 TCCACCACTACGACCACCTTGGG + Intronic
1006487216 6:34353473-34353495 TTCACTACAACCTCCAACTCCGG + Intronic
1010168665 6:72948091-72948113 TCAACTTTTCCTACCAACTCAGG + Intronic
1010226146 6:73491178-73491200 TCTGCTTCTACTACCCACTCTGG - Intronic
1012386240 6:98686611-98686633 TCCTCTACTATGACCAACACTGG + Intergenic
1019700685 7:2473877-2473899 TCTACTACAATTACCAACACCGG - Intergenic
1021240307 7:18192444-18192466 TGCATGACTACTACCAAATCTGG - Intronic
1022850248 7:34254129-34254151 TCCTCCCCTCCTACCAACTCTGG + Intergenic
1023206085 7:37750980-37751002 TCTACTGCTACTACCTTCTCAGG + Intronic
1024688347 7:51772718-51772740 TCCAATATTCCTACCAATTCCGG + Intergenic
1029888189 7:103896388-103896410 CCCAAAACTACTAACAACTCAGG + Intronic
1031416160 7:121498741-121498763 GGAACTACTACTATCAACTCAGG - Intergenic
1038215200 8:25555600-25555622 TCCACTACTCCTACCTAGTCAGG + Intergenic
1038594319 8:28872658-28872680 TCCAATATGACTACCAGCTCAGG - Intronic
1041064114 8:54064630-54064652 TCTACTGCTACTACCACTTCTGG + Intronic
1041942110 8:63399856-63399878 GCCACTGCCACTTCCAACTCTGG + Intergenic
1057825653 9:98370458-98370480 ACCACTCCTAATTCCAACTCTGG + Intronic
1058647935 9:107147972-107147994 TCCACTAGTGGTACCAACTATGG - Intergenic
1060335987 9:122723511-122723533 CCAACTACTACTACCATCTATGG + Intergenic
1203773973 EBV:62658-62680 ACCACGCCTACTACCTACTCCGG - Intergenic
1189730189 X:44011996-44012018 TCCACTCCTACTCCCAAGTCAGG + Intergenic
1193006613 X:76626084-76626106 TCCACTACTACTACCACAGCTGG + Intergenic
1195146918 X:102027189-102027211 GCTACTACTACTACCACCACTGG + Intergenic
1199754022 X:150847873-150847895 TCCACTGCCACTACCAAGCCAGG + Intronic