ID: 1064804830

View in Genome Browser
Species Human (GRCh38)
Location 10:19119064-19119086
Sequence CATAAGATGTAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064804827_1064804830 3 Left 1064804827 10:19119038-19119060 CCAGAGTTGGTAGTAGTAGTGGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG No data
1064804825_1064804830 9 Left 1064804825 10:19119032-19119054 CCTGAGCCAGAGTTGGTAGTAGT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064804830 Original CRISPR CATAAGATGTAGTTGGATTC TGG Intronic
No off target data available for this crispr