ID: 1064804830 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:19119064-19119086 |
| Sequence | CATAAGATGTAGTTGGATTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064804827_1064804830 | 3 | Left | 1064804827 | 10:19119038-19119060 | CCAGAGTTGGTAGTAGTAGTGGA | 0: 1 1: 0 2: 0 3: 7 4: 85 |
||
| Right | 1064804830 | 10:19119064-19119086 | CATAAGATGTAGTTGGATTCTGG | No data | ||||
| 1064804825_1064804830 | 9 | Left | 1064804825 | 10:19119032-19119054 | CCTGAGCCAGAGTTGGTAGTAGT | 0: 1 1: 0 2: 1 3: 6 4: 80 |
||
| Right | 1064804830 | 10:19119064-19119086 | CATAAGATGTAGTTGGATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064804830 | Original CRISPR | CATAAGATGTAGTTGGATTC TGG | Intronic | ||
| No off target data available for this crispr | |||||