ID: 1064806340

View in Genome Browser
Species Human (GRCh38)
Location 10:19138122-19138144
Sequence CTGTTGATGAACATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064806340_1064806343 16 Left 1064806340 10:19138122-19138144 CCTTCTGCCATGTTCATCAACAG 0: 1
1: 0
2: 2
3: 15
4: 192
Right 1064806343 10:19138161-19138183 TCAGCTTTAAACCAAGTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064806340 Original CRISPR CTGTTGATGAACATGGCAGA AGG (reversed) Intronic
901328736 1:8387996-8388018 CTGTTGATGGACATTTCAGTTGG - Intronic
902345826 1:15816657-15816679 TTGTTGTTGAACAAGGCAGTGGG + Intergenic
906717070 1:47978202-47978224 CTGTGTATTTACATGGCAGAAGG - Intronic
907098616 1:51806106-51806128 CTGTTCTTGAACATGGCATAAGG - Intronic
907778562 1:57542941-57542963 CTGCTCAAGAACATGGCAGCTGG - Intronic
909748005 1:79123137-79123159 CTGGTTTTGAAGATGGCAGAAGG - Intergenic
909975169 1:82037253-82037275 CTGTTGATGAGTATTTCAGATGG - Intergenic
911155493 1:94632728-94632750 CTGTTGAAGAAAATGAAAGAAGG - Intergenic
911658686 1:100475627-100475649 CTGTTGATGTCCAAGGCTGAGGG + Intronic
912218431 1:107643795-107643817 CTTTTGAACAACATGCCAGAGGG + Intronic
913033725 1:114938950-114938972 CTGTTGATGGGAATGTCAGATGG + Intronic
914249173 1:145907675-145907697 CTGTACATCAGCATGGCAGAGGG - Intronic
916981690 1:170144799-170144821 CTGTGGGTGCACATGGCATAGGG + Intergenic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
917531717 1:175841905-175841927 TTTTTGATGGACATGGCAGGAGG - Intergenic
918318921 1:183346403-183346425 ATGTTAATTAACAAGGCAGAGGG - Intronic
919925629 1:202190478-202190500 CTCCTGATAAACATGGCATATGG - Intergenic
921193014 1:212726449-212726471 CTGTTTATCAAGATGGCATATGG + Intronic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
922866923 1:228868285-228868307 GTGTTGGAGAACATGCCAGAGGG + Intergenic
1063268327 10:4478526-4478548 CTATTGCTGCACATGGCTGATGG - Intergenic
1064427540 10:15243420-15243442 TTTTTGATGTCCATGGCAGATGG - Intronic
1064806340 10:19138122-19138144 CTGTTGATGAACATGGCAGAAGG - Intronic
1065031201 10:21587854-21587876 CTATTGATAAACTGGGCAGATGG - Intronic
1065667301 10:28075877-28075899 CCGTTGTTGAATAAGGCAGAAGG - Intronic
1067570657 10:47368768-47368790 CTGGTGATCACCATGGCAGCTGG - Exonic
1069729770 10:70603001-70603023 GTGTTGATGAACAGGCCAGCAGG + Intergenic
1074297503 10:112204131-112204153 CTGCTAATGCACATGGTAGAAGG + Intronic
1074376014 10:112941283-112941305 CTTTTGATGATCATGGCGGAAGG + Intergenic
1075357795 10:121798095-121798117 ATGTTAATGAGCAAGGCAGAAGG - Intronic
1075925497 10:126248551-126248573 TTGTTGATGAACCTGTCACATGG - Intronic
1076321628 10:129586823-129586845 CTGTTCATAAAAACGGCAGAGGG - Intronic
1076923923 10:133471755-133471777 CTGGAGAGGAAAATGGCAGAGGG + Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1080792918 11:35537379-35537401 CTGTCAATGAGCATGGGAGAGGG - Intergenic
1086499905 11:87441903-87441925 TTGTTGGTAAACATGGCAGAAGG + Intergenic
1087793919 11:102435669-102435691 CTGTTGATGGACATTGGAGTTGG - Intronic
1088325268 11:108594180-108594202 CTGTGGATGAACCTGGCTGAAGG + Intergenic
1089855913 11:121544708-121544730 ATTTCGATGAACGTGGCAGATGG + Intronic
1090382199 11:126335330-126335352 CTGCTGATAAACTGGGCAGAGGG - Intronic
1090601282 11:128374706-128374728 CTGTTGATGAAAATGTAAAATGG - Intergenic
1093240080 12:16659275-16659297 CTGGTGATGAGCAGGGCAGGTGG + Intergenic
1094294158 12:28885084-28885106 CTGTTGATGACCAAGGAAAATGG - Intergenic
1094354120 12:29559374-29559396 CTGTTCATTTACATGGCAGTGGG - Intronic
1096233353 12:49909798-49909820 CTCGTGATGAAGATGGCAGGGGG - Intergenic
1101233998 12:102769791-102769813 CTGTTCATGACAAAGGCAGATGG + Intergenic
1102778594 12:115543155-115543177 CTGATGAAGAGCATGGCAGTGGG + Intergenic
1104108161 12:125682725-125682747 CTATTGATGGACTTGGCAGCAGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1112000756 13:95207596-95207618 CTGTTTAAGAACATGGTAAATGG + Intronic
1112950649 13:104991972-104991994 CTGTTAACCAATATGGCAGAGGG + Intergenic
1115812283 14:37122752-37122774 CTGTTAGTGATCATGGAAGAGGG - Intronic
1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG + Exonic
1119624860 14:76164228-76164250 ATGGTGATGAACAAAGCAGAGGG - Intronic
1120781624 14:88490702-88490724 GTGTTGGTGAACATAGCAGCCGG - Intronic
1122680702 14:103459933-103459955 CTGGTGATGAATATGGAAAAGGG - Intronic
1126318089 15:47392315-47392337 CTGTTACTGTATATGGCAGAAGG + Intronic
1129097755 15:73226324-73226346 CTTTGGATCACCATGGCAGACGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130630516 15:85563427-85563449 CTGTTGATCAATGTAGCAGATGG + Intronic
1130889573 15:88121937-88121959 ATTTTGATCAACATGGCAGTTGG + Intronic
1131998357 15:98155116-98155138 CTGTTGATGCACAAATCAGATGG - Intergenic
1136392797 16:29975920-29975942 CTGTTGCTGTACATTGCAGACGG + Intronic
1137002625 16:35243101-35243123 CTGTGTCTGCACATGGCAGAAGG - Intergenic
1138798128 16:59994057-59994079 CTGTGGATCATCATGGCGGATGG - Intergenic
1140152198 16:72379432-72379454 CAGTTTATGAACTTGACAGAAGG - Intergenic
1140702578 16:77595226-77595248 CTTTTGAGGCACATGGCAGAAGG - Intergenic
1140916702 16:79500291-79500313 ATGTTGGTGGAGATGGCAGATGG - Intergenic
1141391189 16:83665799-83665821 CTTTAGATTAACATGGAAGATGG - Intronic
1144059112 17:11566513-11566535 CTGGTGTGGATCATGGCAGAAGG + Intergenic
1146013781 17:29216552-29216574 ATGATGATGAACAAGACAGATGG - Intergenic
1147061449 17:37882442-37882464 CTATTGATAAACTGGGCAGATGG + Intergenic
1148046830 17:44749605-44749627 CTGGTCAGGAACATGGCAGGAGG - Intronic
1148964886 17:51426817-51426839 ATGTTGCTTTACATGGCAGAGGG + Intergenic
1150949843 17:69790590-69790612 CTGTTGCTGAAGTTGGGAGAAGG + Intergenic
1152054657 17:78014867-78014889 CTGCTGATGAGCACAGCAGATGG + Intronic
1152779133 17:82218710-82218732 CTGGTGCTGACCACGGCAGAAGG + Intergenic
1155058843 18:22210653-22210675 CTCTTGTTGAATCTGGCAGAGGG + Intergenic
1155535028 18:26808214-26808236 AGGTTGCAGAACATGGCAGATGG + Intergenic
1155735932 18:29222236-29222258 TTGCTGATCCACATGGCAGAAGG - Intergenic
1157327030 18:46676805-46676827 CTGTGGAGGAACATGGCAGAAGG + Intronic
1158081918 18:53602457-53602479 GTGTTGTTGAGCATTGCAGATGG - Intergenic
1160365386 18:78320237-78320259 CAGATAATGAAAATGGCAGAAGG - Intergenic
1160488532 18:79316674-79316696 CTCTTGATGCACATGGCATCTGG - Intronic
1165928248 19:39340958-39340980 CTGTCGATGAATATTGCAAAAGG - Intronic
1168505639 19:56932402-56932424 CTGTTGATGAAGATGTCACAAGG - Intergenic
927684957 2:25164082-25164104 CTGTAGAGGAACACAGCAGAAGG + Intronic
932429166 2:71663649-71663671 CCTTTGATGCACATGGTAGATGG + Intronic
933428680 2:82146223-82146245 CTCTTGATAATCATGTCAGAGGG + Intergenic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
934544096 2:95200186-95200208 CTGTTCATCATCATGGAAGAGGG - Intergenic
934906896 2:98213138-98213160 CTGTTGATGTCCTGGGCAGAAGG + Intronic
935211090 2:100939771-100939793 CAGTTGCTGTACGTGGCAGACGG + Intronic
935628956 2:105196288-105196310 CTGTCTATGAACCAGGCAGAGGG - Intergenic
937570964 2:123360844-123360866 TTGCTGATGAAAATGGGAGAAGG - Intergenic
938016744 2:127873540-127873562 CTGTTGGTTCACATGGCAGTGGG - Intronic
941834562 2:170002383-170002405 CTGCTGAGGAAAATGGGAGAGGG - Intronic
942703812 2:178745699-178745721 CTGTTGAGGAAAGTGGCACAGGG - Intronic
943985841 2:194617116-194617138 CAGTTGTTCAACATAGCAGATGG - Intergenic
946255799 2:218440953-218440975 CTGGGGATGAACAAGACAGATGG + Intronic
947458030 2:230274287-230274309 CTGTTACTTTACATGGCAGAAGG + Intronic
1169853071 20:10074451-10074473 CTGATGGGAAACATGGCAGAGGG + Intergenic
1175487759 20:59357457-59357479 CTGGTGATGAACACATCAGATGG - Intergenic
1175535813 20:59710622-59710644 CTGTTCATTAAAATAGCAGAGGG - Intronic
1176253641 20:64139398-64139420 CTCTTGAGGTACCTGGCAGAAGG + Intergenic
1179392405 21:41005722-41005744 CTGTTGATGAACATGTCTTCCGG + Intergenic
1179726770 21:43345328-43345350 CTGCTTATGAGCATGGCACATGG + Intergenic
1181668268 22:24413095-24413117 CTCTAGATGAACAAGGCAGATGG - Intronic
1182764920 22:32751587-32751609 CTGGTGGTGACCTTGGCAGAGGG + Intronic
1183169485 22:36175826-36175848 TCGTTGATGCACAAGGCAGATGG - Intergenic
1184306905 22:43609755-43609777 CTCTTGAAGAACAAGGTAGAGGG + Intronic
949115255 3:313106-313128 TTGTCAATGAAAATGGCAGATGG + Intronic
949329423 3:2905415-2905437 CTGTGTTTGCACATGGCAGAAGG + Intronic
950099988 3:10350706-10350728 CTGATGACGCACATGGCATATGG + Intronic
951179300 3:19640238-19640260 CTGTGTAGTAACATGGCAGAAGG - Intergenic
951737422 3:25883401-25883423 ATGTTGATCCAGATGGCAGAAGG + Intergenic
951811546 3:26706122-26706144 CTGTTTCTTCACATGGCAGAAGG + Intronic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
955175795 3:56612083-56612105 GAGTTGAGGACCATGGCAGATGG - Intronic
955390898 3:58521524-58521546 CTGACCATGAGCATGGCAGAAGG - Intronic
956456773 3:69429356-69429378 CTGTTGATGAGAATGCCAGTAGG - Intronic
956883695 3:73537000-73537022 CTGTTGAGGACCAGGGCAGAAGG - Intronic
957679916 3:83420481-83420503 CTGTTGTAGAAAATGGCATATGG + Intergenic
958805718 3:98807460-98807482 CTGTTGATGAATGAGCCAGACGG + Intronic
960218256 3:115070415-115070437 CTGTAGATAAGCATGGCAGCAGG + Intronic
960464770 3:117983948-117983970 TTGTTTCTGAACATAGCAGAAGG - Intergenic
962400937 3:135058239-135058261 CAGTTGATGAATGTGGCAGAGGG + Intronic
963459422 3:145589641-145589663 GTGTTGTTGGACATGTCAGAGGG - Intergenic
964710955 3:159671080-159671102 CTGCTGATGAACAGAGCAGGTGG + Intronic
965243901 3:166241273-166241295 TTCTTAATGAACAAGGCAGATGG - Intergenic
967143217 3:186581615-186581637 CTTTTGCAGAACATGGCAGTGGG - Intronic
967404042 3:189096519-189096541 CTGTAGAAGAACAGGTCAGAAGG - Intronic
970602913 4:17654490-17654512 CTGTTGAAAAATATGGCAGCAGG - Intronic
971336510 4:25728404-25728426 CTGTTGATGAGAATGGCCCATGG - Intergenic
973734464 4:53856796-53856818 CTATGGATGAACATGGAACATGG + Intronic
975299110 4:72768448-72768470 CTGTCGGTGAGCATGGAAGAGGG - Intergenic
976546434 4:86340763-86340785 GTTTAGATGAACATAGCAGAAGG - Intronic
976806298 4:89051282-89051304 CTGTTTCTTTACATGGCAGAGGG + Intronic
977360555 4:95999165-95999187 CTGTATTTGAACATGGCAGAAGG + Intergenic
977587767 4:98793742-98793764 GTGATCATGAACATGGCAGCTGG - Intergenic
984585527 4:181560207-181560229 CTGTGGCTTCACATGGCAGAAGG + Intergenic
986096116 5:4555448-4555470 CTGGTTGTGAACATGGCTGAGGG + Intergenic
986526966 5:8689153-8689175 TTGTGGATCAACGTGGCAGAAGG + Intergenic
987304148 5:16621952-16621974 CTGTAGGAGAACTTGGCAGAGGG + Intergenic
988509195 5:31851789-31851811 CTGCTGATGAGAATGGCATATGG + Intronic
990247477 5:53877496-53877518 GTGGTGATTAACATGCCAGATGG + Intergenic
990564368 5:57014715-57014737 ATGTTGCTCTACATGGCAGAAGG + Intergenic
993480055 5:88413479-88413501 CTATTGATGAATATGGCAAATGG + Intergenic
994379599 5:99055936-99055958 CTCTTGATCTGCATGGCAGAAGG + Intergenic
996519876 5:124414672-124414694 CTCTTTATTTACATGGCAGAGGG - Intergenic
1000466370 5:161582743-161582765 TTGTTGATCACCAGGGCAGAGGG - Intronic
1001411596 5:171516017-171516039 CAGTGGATGAACCTGACAGAAGG + Intergenic
1004969793 6:20897117-20897139 CTGTTTATTCACATGACAGAAGG + Intronic
1008273233 6:49514399-49514421 CTGTTGATGAACATGAATGGTGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1009194995 6:60673679-60673701 CTGTTGATGAACATGTTGGTTGG + Intergenic
1010076518 6:71804205-71804227 TTGTGGATCATCATGGCAGATGG - Intergenic
1012815722 6:104019360-104019382 CTGCTGCTGAACAAGGGAGAAGG + Intergenic
1014004880 6:116406714-116406736 CCCTTAATGGACATGGCAGAAGG - Intronic
1017028199 6:150198791-150198813 CTGATGATGAGCGAGGCAGATGG - Intronic
1019812185 7:3172930-3172952 CTGCTCATGATGATGGCAGAAGG + Intronic
1021032682 7:15757496-15757518 ATGTTAATTAACATGGCAAAAGG - Intergenic
1023072503 7:36450464-36450486 CTGTTGCTGGATATTGCAGATGG + Intronic
1024209392 7:47190697-47190719 CTGCTGATGCGGATGGCAGATGG - Intergenic
1024339169 7:48239559-48239581 CAGTTGATGCACATGGGACAAGG - Intronic
1027835623 7:83237761-83237783 CTGTAGTTGAATTTGGCAGATGG - Intergenic
1028993716 7:97076808-97076830 CTTTAGATCATCATGGCAGACGG - Intergenic
1030196656 7:106859447-106859469 CTGTTCAAGAGCATAGCAGAGGG - Intergenic
1032876178 7:136040836-136040858 CTCTTGATGAAGAGGCCAGATGG - Intergenic
1033580522 7:142728895-142728917 CTGTTGGGGAACTGGGCAGAGGG - Intergenic
1035324766 7:158057780-158057802 GTGCACATGAACATGGCAGATGG - Intronic
1035742777 8:1941075-1941097 CTGTGAATAAAAATGGCAGAAGG - Intronic
1036426420 8:8649130-8649152 CTGTTAGTGCACATGGCAGCGGG + Intergenic
1037849096 8:22311679-22311701 CTGGTGATGAACTTGGCAGATGG + Intronic
1038879587 8:31593272-31593294 TTGTTACTGAACATGGCAGGAGG + Intergenic
1039179112 8:34844057-34844079 CTGTTGGGGAGCATTGCAGATGG + Intergenic
1041639140 8:60178173-60178195 TTGTTGATGAAAATGGCTGCAGG - Intergenic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1043561486 8:81498886-81498908 CTATTTCTTAACATGGCAGAAGG + Intergenic
1043765572 8:84127461-84127483 CTGTTGACAAACATGTCATAAGG - Intergenic
1044477465 8:92645324-92645346 CTCTGTATGCACATGGCAGAAGG + Intergenic
1045150995 8:99407963-99407985 AGGTTGAAGAACATAGCAGAAGG - Intronic
1047098417 8:121649203-121649225 CTGTCCATGAACATGCCTGAGGG - Intergenic
1048147956 8:131863946-131863968 CTCTTGCTGAAAATGGAAGAAGG - Intergenic
1049287826 8:141786081-141786103 CTGCTGATGGACATGGCTGGGGG + Intergenic
1050232626 9:3543785-3543807 ATGTAGATGAACATGTCAGCTGG + Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1050938882 9:11433506-11433528 CTGGAGATGAACATGGCACAGGG + Intergenic
1051018417 9:12510181-12510203 CTGAGGATGATCATGGTAGAGGG - Intergenic
1052609307 9:30750319-30750341 CTGGTTATGAGCAGGGCAGAGGG + Intergenic
1053254217 9:36602169-36602191 CTGTTGGTGAAAATGTAAGATGG - Intronic
1055842634 9:80524137-80524159 CTGTTATTGAAAATGACAGAAGG - Intergenic
1056657414 9:88520759-88520781 CCGTTCATGACCATGGGAGATGG - Intergenic
1057076250 9:92139653-92139675 CTCCTGATAAACATGGCATATGG - Intergenic
1061557884 9:131383077-131383099 CTGTGGAGGAACATTCCAGATGG - Intergenic
1061958624 9:133976773-133976795 CTGTGGATGAACCTGGAAAATGG - Intronic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1185957345 X:4505925-4505947 CTGTTTCTGTTCATGGCAGAAGG + Intergenic
1186054402 X:5633390-5633412 CTGTTGATGATGATGGCAGTGGG - Intergenic
1186251706 X:7674589-7674611 CTGTTGGTGAAAATGGAAAAGGG + Intergenic
1189259269 X:39666625-39666647 CTGTTACGGAACATGGCAGCAGG + Intergenic
1192878100 X:75253541-75253563 CTTTAGAGGATCATGGCAGATGG + Intergenic
1193076867 X:77364170-77364192 CTGTCAAGGATCATGGCAGATGG + Intergenic
1195777181 X:108420284-108420306 CTGCTTATTATCATGGCAGAAGG - Intronic
1196573047 X:117285614-117285636 TTGTTTATTATCATGGCAGAGGG + Intergenic
1201467565 Y:14300606-14300628 CTGTTGGTGAAAATGGAAAAGGG + Intergenic
1202254854 Y:22910430-22910452 ATGTTGTTGAACATGGCACCTGG + Intergenic
1202407845 Y:24544179-24544201 ATGTTGTTGAACATGGCACCTGG + Intergenic
1202462937 Y:25125902-25125924 ATGTTGTTGAACATGGCACCTGG - Intergenic