ID: 1064808775

View in Genome Browser
Species Human (GRCh38)
Location 10:19168660-19168682
Sequence CATATTAACTAGTTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064808774_1064808775 -7 Left 1064808774 10:19168644-19168666 CCTTATTATCTGGGGGCATATTA 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1064808775 10:19168660-19168682 CATATTAACTAGTTTGTAGATGG No data
1064808773_1064808775 -6 Left 1064808773 10:19168643-19168665 CCCTTATTATCTGGGGGCATATT 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1064808775 10:19168660-19168682 CATATTAACTAGTTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064808775 Original CRISPR CATATTAACTAGTTTGTAGA TGG Intronic
No off target data available for this crispr