ID: 1064810247

View in Genome Browser
Species Human (GRCh38)
Location 10:19188855-19188877
Sequence CAGTAGAGATGGTCAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064810240_1064810247 28 Left 1064810240 10:19188804-19188826 CCAAGGACTGAATAAGGAAATGA 0: 1
1: 0
2: 2
3: 21
4: 329
Right 1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064810247 Original CRISPR CAGTAGAGATGGTCAGAAGT GGG Intronic
No off target data available for this crispr