ID: 1064811652

View in Genome Browser
Species Human (GRCh38)
Location 10:19206735-19206757
Sequence TTTTATGGAAAGGTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064811645_1064811652 24 Left 1064811645 10:19206688-19206710 CCACAAATCCATGTTGGATTTCC No data
Right 1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG No data
1064811646_1064811652 16 Left 1064811646 10:19206696-19206718 CCATGTTGGATTTCCTGAAATAT 0: 1
1: 0
2: 0
3: 22
4: 240
Right 1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG No data
1064811647_1064811652 3 Left 1064811647 10:19206709-19206731 CCTGAAATATATTGAGAGATGCG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1064811652 10:19206735-19206757 TTTTATGGAAAGGTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064811652 Original CRISPR TTTTATGGAAAGGTGGAGCT AGG Intronic
No off target data available for this crispr