ID: 1064813393

View in Genome Browser
Species Human (GRCh38)
Location 10:19228678-19228700
Sequence GTGTTCTAATTGAAATGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064813393_1064813395 12 Left 1064813393 10:19228678-19228700 CCAACACATTTCAATTAGAACAC 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1064813395 10:19228713-19228735 GTTACAGCTATGCTCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064813393 Original CRISPR GTGTTCTAATTGAAATGTGT TGG (reversed) Intronic
901298331 1:8178410-8178432 GTTTTTTAATTAAAATGAGTAGG + Intergenic
904487026 1:30832045-30832067 GTGTAATCATTAAAATGTGTAGG + Intergenic
904674040 1:32187223-32187245 GTGTTGAAATTGTAATGTTTTGG + Intronic
905039543 1:34944201-34944223 TTATTCTACTTGAAATTTGTTGG - Intergenic
906337009 1:44941816-44941838 TTGTTCTCATTGAATTGTGCTGG + Intronic
906591233 1:47025933-47025955 TTGTTTTAATTGAATTGTTTTGG + Intronic
908571130 1:65411489-65411511 GTGTTTTACTTTAAATGTGCTGG + Intronic
909219405 1:72936464-72936486 GTGTTCAAATTGCACTGAGTAGG + Intergenic
910132414 1:83924216-83924238 GAGTACTATTTGAAATGTGGGGG + Intronic
911136021 1:94441516-94441538 GTGTTCAAATACAGATGTGTAGG + Intronic
913030248 1:114894827-114894849 GAGTTCAAAATGAAATGTGTAGG + Intronic
914907999 1:151762494-151762516 CTGTTCTAATTGACAGATGTTGG - Exonic
916355388 1:163900164-163900186 TTGTTTTAAATCAAATGTGTAGG - Intergenic
916578484 1:166087782-166087804 GTGTGATGTTTGAAATGTGTAGG + Intronic
917839502 1:178966238-178966260 GTGTTCTCACTGAAATGTCCTGG + Intergenic
918508088 1:185280151-185280173 GAGTTCTCATTGAAATCTGATGG + Intronic
921998368 1:221446904-221446926 ATTTTAAAATTGAAATGTGTAGG + Intergenic
923282671 1:232459825-232459847 TTTTTCTAAATTAAATGTGTGGG + Intronic
923684527 1:236144703-236144725 GTTTTGTAATTGAAATGAGGTGG + Intronic
924665676 1:246069361-246069383 CTGTTTTATGTGAAATGTGTTGG - Intronic
1062992099 10:1829744-1829766 GTGTTAAAATTGATATGTATAGG + Intergenic
1063043178 10:2364465-2364487 ATATTGTAATTGAAATTTGTAGG - Intergenic
1064169836 10:13021081-13021103 GTGTTCAAACTCAAAAGTGTAGG + Intronic
1064479584 10:15725926-15725948 GTGATCTTATTCAAGTGTGTGGG + Intergenic
1064813393 10:19228678-19228700 GTGTTCTAATTGAAATGTGTTGG - Intronic
1065662127 10:28016522-28016544 GTGCTTTACTTGAAATGTGTGGG + Intergenic
1066286912 10:33976579-33976601 ATGTTCTAAGAGAAATGGGTGGG + Intergenic
1069108400 10:64411600-64411622 GAGTTCTGATTGAAATGGTTGGG + Intergenic
1069275880 10:66589830-66589852 TTTTTCCCATTGAAATGTGTGGG - Intronic
1069586637 10:69609128-69609150 ATTTTCTAATTGAATTGTTTGGG - Intergenic
1072248764 10:93565691-93565713 GTGGTGTGATGGAAATGTGTGGG + Intergenic
1072525869 10:96271142-96271164 GAGTTCTTAAAGAAATGTGTAGG - Intronic
1073463308 10:103678870-103678892 ATGTTCTAATTAATATGTGTTGG - Intronic
1076712368 10:132345359-132345381 GTGCTGCAATTGAAATGTGTGGG + Intronic
1077483774 11:2829580-2829602 GAATTCTAATTTAACTGTGTTGG + Intronic
1077856454 11:6131099-6131121 GTATTCAAATTGGAATGGGTTGG + Intergenic
1079397912 11:20081927-20081949 ATGTTCTCATTAAAATGTTTAGG + Intronic
1079546605 11:21640786-21640808 GAATTCTAAATGAAATTTGTTGG + Intergenic
1082703933 11:56469272-56469294 GTTTTCTTATTGAAAAGTGCAGG - Intergenic
1084080696 11:66822472-66822494 CTGCTCTGATGGAAATGTGTGGG + Intronic
1085190644 11:74618202-74618224 GTATTCTAATTCAAAAGAGTAGG - Intronic
1086284041 11:85224990-85225012 ATGTTTTAATTGAAATTAGTTGG - Intronic
1086640507 11:89149347-89149369 TTGTGCTGATTGAGATGTGTTGG + Intergenic
1087167191 11:95016681-95016703 GTGTTCAACTTGAAATGAGAAGG + Intergenic
1090604072 11:128403235-128403257 GTGAGCTAATGGAAATGTTTTGG + Intergenic
1090741978 11:129670715-129670737 GTCTTCTAATTGGATTGTTTAGG - Intergenic
1091435708 12:471064-471086 TTGTTCTATTTCAAATTTGTTGG + Intronic
1092936138 12:13366358-13366380 GGGTTCTAAATGAAATGAGCAGG - Intergenic
1093510116 12:19916879-19916901 GTGTTGTAAATGAAATTTGATGG - Intergenic
1093878531 12:24377356-24377378 ATGTTTTAATTGAATTGTTTTGG - Intergenic
1096695713 12:53346876-53346898 GTGTTGTACTGGAAATGTGATGG - Intergenic
1100008412 12:89922558-89922580 GTGTTCTGATGGAAATGTCCTGG + Intergenic
1102550399 12:113687523-113687545 GAGTCCAAATTGAAATGTATGGG + Intergenic
1102675311 12:114654021-114654043 GAGTTATCATTGAAATGTCTAGG + Intergenic
1102805728 12:115778524-115778546 GTGTTCTGATTGAATTTTGCTGG - Intergenic
1104337400 12:127912463-127912485 GTGTCATAAATGAAATGTGCTGG + Intergenic
1104539219 12:129646676-129646698 GTGTTCTTATACAAATGCGTGGG + Intronic
1107069684 13:36256627-36256649 GGGTTCTAAATGAAATGAGTAGG - Intronic
1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG + Intergenic
1110147208 13:72206019-72206041 GAGGTCTCATTGAAATGTGGAGG + Intergenic
1112218926 13:97467887-97467909 ATGTTTTAATTGAAATGTCAAGG - Exonic
1115599710 14:34943585-34943607 GTTTTCTTATTTAAATGTTTTGG - Intergenic
1117278385 14:54212906-54212928 GTGTACTAAGTAAAATCTGTGGG - Intergenic
1118269692 14:64331061-64331083 GTCTTTTAATTGGAATGTTTAGG - Intronic
1120649108 14:87109742-87109764 CGCTTCTAATTGAAATGTGGTGG - Intergenic
1121641230 14:95486089-95486111 GTGTTTCCACTGAAATGTGTGGG - Intergenic
1123159782 14:106267330-106267352 GTATTGCAATTGAAATGTATGGG + Intergenic
1123782670 15:23643727-23643749 GTGTTTTAATTGTTATGTTTTGG - Exonic
1124379166 15:29150078-29150100 GTGTTGGATTTGAAATGTGTAGG - Intronic
1126650175 15:50912170-50912192 GATTTCAAATTCAAATGTGTTGG - Intronic
1128191857 15:65708397-65708419 TTGTTCTCATAGAAAAGTGTGGG + Intronic
1133541875 16:6763784-6763806 GTGTTCACACTGAAACGTGTGGG + Intronic
1134437222 16:14271451-14271473 GTTTTTAAATTGAGATGTGTGGG - Intergenic
1135967963 16:27051552-27051574 GTGTGCTAATTTAGAAGTGTGGG + Intergenic
1140690164 16:77475229-77475251 TTGTTCTGATTGATATGTATAGG + Intergenic
1140982142 16:80120852-80120874 GTGTTAGCATTGAAATGTATTGG + Intergenic
1148008040 17:44450236-44450258 ATGTTCTAATTGATAAATGTTGG - Intronic
1149905671 17:60524891-60524913 GTGTTCACATTCAAATGTGGGGG + Intronic
1150822750 17:68448799-68448821 GTGTTTTCACTGAAATCTGTTGG - Intronic
1150852485 17:68717141-68717163 GAGTTCTCATTGCATTGTGTTGG + Intergenic
1151736433 17:75943824-75943846 GAGGTTTAATAGAAATGTGTTGG - Exonic
1156105063 18:33649799-33649821 GTGTTCTGAAGGAAATGAGTTGG + Intronic
1156318092 18:35989820-35989842 ATGTTCTTTTTGAAATGTGTAGG - Exonic
1158288720 18:55914943-55914965 GTGCTCTCATTTTAATGTGTTGG + Intergenic
1158516170 18:58131731-58131753 GTGATCTAGTTGAACTGTGGTGG + Intronic
1159484300 18:69034467-69034489 ATTTCCTAATTGAAATGTTTTGG + Intronic
1163890036 19:20002666-20002688 GTGTTCCAATTGGAGTGAGTTGG - Intronic
1164608977 19:29619444-29619466 GGGTTCTAATAGAACTGTATTGG + Intergenic
1164923907 19:32110896-32110918 GTTTTGTAGTTGAAATGTCTCGG - Intergenic
1168598203 19:57695998-57696020 GTGTGCTAATTGGAGTCTGTGGG + Intronic
928978736 2:37116741-37116763 ATGTTCAAGTTGCAATGTGTAGG + Intronic
930193461 2:48484091-48484113 GTGTTCTGAAAGGAATGTGTGGG - Intronic
931701274 2:64910983-64911005 GTCTGCTAATTGACAGGTGTGGG + Intergenic
931936943 2:67209190-67209212 GTGTGCTGATTGAAAAGTGATGG + Intergenic
932512398 2:72307059-72307081 TTGTTCTGATTGTAATGTGGAGG - Intronic
933167804 2:79094863-79094885 GTGTTCAAACAGAAGTGTGTAGG + Intergenic
935617104 2:105097680-105097702 GTTTTATCATAGAAATGTGTGGG + Intronic
936381811 2:111993002-111993024 GTGTTGGAATTGAACTGGGTTGG + Intronic
939302001 2:140354844-140354866 ATATTCTAATTGAAGTGTTTGGG + Intronic
939680928 2:145130886-145130908 GTTTTCTAATTCATATATGTTGG - Intergenic
940497235 2:154447563-154447585 GTGTTCTCATTGTAAGGTCTGGG - Intronic
944542019 2:200763247-200763269 GGGCTCTGATTGGAATGTGTGGG - Intergenic
945565681 2:211396686-211396708 GTGTTTTAAGTGATAGGTGTTGG + Intronic
947411438 2:229844948-229844970 GTGTAATAGTAGAAATGTGTTGG - Intronic
948934423 2:241153448-241153470 GAATTCTCATTGACATGTGTGGG + Intronic
1171109053 20:22463639-22463661 GGATTCTTATTGAAATGAGTGGG - Intergenic
1175678097 20:60964615-60964637 TAGTTGTACTTGAAATGTGTAGG + Intergenic
1177702689 21:24658869-24658891 GTGATTTAAGTGAAATGTATTGG - Intergenic
1184496341 22:44844417-44844439 GTCTTTTAATTGGAATGTTTAGG - Intronic
950349985 3:12340280-12340302 GTCTTCTCATTTCAATGTGTAGG + Intronic
951802211 3:26608341-26608363 GTGTGCTGTTGGAAATGTGTGGG - Intergenic
952563432 3:34624842-34624864 GTGTACTAATTCCAATGTCTAGG + Intergenic
954066786 3:48113063-48113085 GTGTTCTATTTGGCATTTGTAGG - Intergenic
954169492 3:48789305-48789327 GTGTTCCAATTGACATCAGTAGG - Intronic
956533083 3:70243057-70243079 GAGTTCTAATTGTAAGGTGGAGG + Intergenic
959747154 3:109790037-109790059 GTTTTCTAATTGAATTGGCTAGG + Intergenic
960247122 3:115412067-115412089 GTTTTCTAACTGAAATTTATAGG - Intergenic
960289039 3:115861613-115861635 GTATTCTAAATGCAGTGTGTAGG + Intronic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
961392836 3:126565924-126565946 GTTTTCTAATTAAGAAGTGTGGG - Intergenic
965747925 3:171944871-171944893 GTGTTCTCAGTGACATTTGTTGG + Intergenic
965908429 3:173740140-173740162 ATGTTCTTATTGCAATGAGTTGG - Intronic
966099084 3:176243865-176243887 ATGGTCTAATTCAAATGTTTAGG - Intergenic
967637159 3:191816280-191816302 TTATGCTAATTGAAATGAGTCGG + Intergenic
968780032 4:2573547-2573569 GTGTTTTTATTGCCATGTGTGGG + Intronic
969899676 4:10337374-10337396 GGCTCCCAATTGAAATGTGTAGG + Intergenic
970884528 4:20972448-20972470 GAGTTCTAATGGAGATGTATAGG - Intronic
971548476 4:27917667-27917689 GTGATCTAATTGGAATGAGAAGG + Intergenic
971679001 4:29672847-29672869 ATGTTCTAATTAAAATGTATCGG - Intergenic
972062398 4:34892853-34892875 GTTTTCATATTGAAATTTGTTGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972959959 4:44441701-44441723 GTGTTCTAATTGAACTATTAGGG + Intronic
976104409 4:81601401-81601423 GTGTTCTTATAGATATATGTGGG - Intronic
977419192 4:96775678-96775700 GTGTTCTATTTCTAATGTCTAGG + Intergenic
977587545 4:98790701-98790723 CTGTTCTCATTCACATGTGTGGG - Intergenic
978399513 4:108315800-108315822 GTTTTATACTTGAAATGTGGAGG + Intergenic
979417917 4:120466120-120466142 GTGGTCTAATTGACCTGTTTTGG - Intergenic
979942840 4:126784103-126784125 GTGTTGGAATTGAAATCAGTAGG - Intergenic
981138821 4:141243234-141243256 GTCTTCTAATTGGAGTGTTTGGG + Intergenic
981193541 4:141891560-141891582 GACTTCTAATTGATATGTTTTGG - Intergenic
981721255 4:147803655-147803677 ATGTTCTCACTCAAATGTGTGGG - Intronic
981965846 4:150602112-150602134 GTGTTGTAACTGGATTGTGTTGG - Intronic
982618482 4:157673939-157673961 GTGTTGTAACTGAAATGTAAAGG + Intergenic
986817588 5:11429592-11429614 ATGGTCTAAATGAAATGAGTTGG + Intronic
987760687 5:22159370-22159392 ATTTTCTAATGAAAATGTGTAGG - Intronic
990344144 5:54854816-54854838 GTGTACTATTTTCAATGTGTGGG - Intergenic
991176348 5:63691284-63691306 ATATCCTAAGTGAAATGTGTGGG - Intergenic
991895461 5:71392821-71392843 ATTTTCTAATGAAAATGTGTAGG - Intergenic
993314406 5:86382481-86382503 GTGTTGGAATGGAAATGTGGAGG - Intergenic
993392866 5:87342752-87342774 GTTGTCTAGTTGATATGTGTAGG + Intronic
993936173 5:94005694-94005716 GTTTTCTAATGGAATTGTTTGGG - Intronic
996428922 5:123348666-123348688 CTGTTTTAAATGTAATGTGTAGG + Intronic
996889914 5:128406216-128406238 GTGTTCAAATTGAAAGCAGTTGG - Intronic
997096386 5:130918144-130918166 ATGTTCTCATTGATATATGTGGG + Intergenic
997318601 5:132959048-132959070 GAGTTCTTAATGAACTGTGTTGG - Intronic
998495541 5:142585445-142585467 GTGTTATAATTCAGCTGTGTGGG + Intergenic
999122715 5:149221465-149221487 GTGTTTTAATTGCTATGTGATGG + Intronic
999494964 5:152087707-152087729 GTGTTTATATTGAAGTGTGTAGG + Intergenic
1004587117 6:17013260-17013282 GCTTTCTCATTGAAATGTGTGGG + Intergenic
1005536012 6:26756379-26756401 GTATTTTAATTGAAATGTCAGGG + Intergenic
1007046327 6:38778641-38778663 ATGTTCTAATTGCATTGTTTTGG + Intronic
1009940675 6:70283979-70284001 GTTTTCTAATGGAAATGGGTTGG + Intronic
1011287008 6:85735621-85735643 GTATTTTAAGTGAAATGTCTAGG + Intergenic
1012779611 6:103540897-103540919 GTGTACTAAAAGAAATGTGTTGG - Intergenic
1013005981 6:106073888-106073910 GTGTTCTTATTCAAATGTTAGGG + Intergenic
1013688345 6:112610991-112611013 GTGTTGAAATTGAAATTTTTTGG + Intergenic
1014097110 6:117472495-117472517 GTGTTCTACTTGGAATTTCTAGG + Intronic
1014804813 6:125817600-125817622 ATTTTCTAATTGAATTGTTTAGG + Intronic
1016802662 6:148182421-148182443 GTGTTCTGAGTGAGATGTTTGGG + Intergenic
1017102082 6:150857813-150857835 GTGTTCTAGAAGGAATGTGTAGG - Intergenic
1018570455 6:165204229-165204251 GTATTCTAATTGATATGGTTTGG - Intergenic
1019751638 7:2734444-2734466 GTGTTCTCATGGAAATGTACAGG + Intronic
1020960210 7:14793378-14793400 GTGTCCTAACTGAGATGCGTAGG - Intronic
1021505184 7:21376160-21376182 ATGTTCTACTTTAAAAGTGTTGG - Intergenic
1021856761 7:24864691-24864713 GTGCTCTGATTGAATTGTCTGGG - Intronic
1021900189 7:25277602-25277624 GTGTTCAAAGTCACATGTGTTGG - Intergenic
1022063641 7:26827499-26827521 GTATTTTAATTTAAATGTTTAGG - Intronic
1023449750 7:40270490-40270512 CTCTTCCAATTGAATTGTGTTGG + Intronic
1025901641 7:65749904-65749926 GTGTTATACTTTAAATGTCTTGG - Intergenic
1026924816 7:74183569-74183591 GTGTTGTTATTGATCTGTGTAGG + Intronic
1027562686 7:79751814-79751836 GTATTAAAATTGATATGTGTAGG - Intergenic
1027764596 7:82323823-82323845 GTCTTCTAAATGAAATCTCTTGG - Intronic
1028070986 7:86450397-86450419 GTGTTCATCTTGTAATGTGTTGG + Intergenic
1031319003 7:120297765-120297787 GTGCTCTAATTGAAATATTTTGG + Intronic
1031658972 7:124396849-124396871 GTTTTAAAAGTGAAATGTGTTGG + Intergenic
1032119153 7:129144267-129144289 TTGGTCTAATTGTTATGTGTAGG + Intergenic
1032307509 7:130750125-130750147 GTGTTCTATTTCTAATGTGTAGG + Intergenic
1032319203 7:130869530-130869552 GTGTTCTAACTAAATTGTGAAGG + Intergenic
1033551878 7:142455012-142455034 GTGTTCTAATAGAAATGCTGGGG + Intergenic
1034388781 7:150765644-150765666 GTGTTCTGAGTGACATGTTTTGG + Intergenic
1038453376 8:27654586-27654608 TTTTTTTAATTGAAATGAGTTGG - Intronic
1039348990 8:36740455-36740477 GTGCTCTAATTGGCATTTGTGGG + Intergenic
1042301841 8:67291795-67291817 GTGTGTTAAGGGAAATGTGTAGG - Intronic
1043219314 8:77639158-77639180 CTGTTTTAAATGAAATATGTAGG + Intergenic
1043743053 8:83838380-83838402 GTGTTAAAATAGAAATGTTTTGG + Intergenic
1046291882 8:112172988-112173010 TTGTAATAATTAAAATGTGTTGG + Intergenic
1046555801 8:115771606-115771628 ATGTTGTAATTGAAATTTGGAGG - Intronic
1052892311 9:33713409-33713431 GTCTTCTAATTGGATTGTTTAGG - Intergenic
1055776141 9:79768912-79768934 GTGGCCTGATTGAGATGTGTTGG - Intergenic
1055994489 9:82142533-82142555 GTGTTCTAAAAGAAGTCTGTGGG - Intergenic
1056230942 9:84542880-84542902 TTATGCTCATTGAAATGTGTTGG + Intergenic
1059456735 9:114404450-114404472 ATCTTCTAATTTGAATGTGTTGG - Intronic
1186251792 X:7675790-7675812 GGTATCTAATTGAAATCTGTAGG + Intergenic
1186536826 X:10358717-10358739 GTGATTTGATTGACATGTGTAGG - Intergenic
1187049548 X:15682261-15682283 ATGTTCTCATTGAAATGAGTTGG + Intergenic
1188096389 X:26028317-26028339 GTTTTCTCTTTAAAATGTGTGGG - Intergenic
1188320499 X:28731282-28731304 ATGTTCTCACTGAACTGTGTTGG + Intronic
1188832667 X:34919298-34919320 GTATTCTAAGTGAAAGTTGTTGG - Intergenic
1195091639 X:101465225-101465247 GTGTTTTAACTGGAATGTTTAGG - Intronic
1195612845 X:106888473-106888495 ATTTTCTAATTGAATTGTTTTGG + Intronic
1195864705 X:109417671-109417693 GTCTTCTAATTGAAATGTTTAGG - Intronic
1199088284 X:143659393-143659415 GTGTTCTGTTTGAAATCTGCTGG + Intergenic
1199852457 X:151735456-151735478 GTGTTCTAAGTGAAATGGGAGGG - Intergenic
1200169113 X:154059452-154059474 ATGCTCTAATTGAACTTTGTGGG - Intronic
1200874753 Y:8141488-8141510 GATTTCTAATGGAAATGTGCTGG - Intergenic
1200907973 Y:8504570-8504592 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1200987253 Y:9315602-9315624 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1201467648 Y:14301826-14301848 GGTATCTAATTGAAGTGTGTAGG + Intergenic
1201746347 Y:17378391-17378413 GTGTTCTGTTAGAAATATGTGGG + Intergenic
1202101737 Y:21315901-21315923 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202108638 Y:21398163-21398185 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202118334 Y:21497045-21497067 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1202120786 Y:21520585-21520607 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202123237 Y:21544126-21544148 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202155769 Y:21885255-21885277 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202158217 Y:21908796-21908818 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202160518 Y:21930225-21930247 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202184670 Y:22173721-22173743 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202187562 Y:22202869-22202891 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202188511 Y:22215689-22215711 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202203798 Y:22383527-22383549 GTCTTCTAATGGAAATGTGCTGG + Intronic
1202206690 Y:22412680-22412702 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202230838 Y:22656150-22656172 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1202312320 Y:23540015-23540037 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202558483 Y:26130579-26130601 ATTTTCCAATGGAAATGTGTTGG - Intergenic