ID: 1064813909

View in Genome Browser
Species Human (GRCh38)
Location 10:19234697-19234719
Sequence CATAGTGTCTGGAGTATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064813909_1064813914 10 Left 1064813909 10:19234697-19234719 CCTACTATACTCCAGACACTATG No data
Right 1064813914 10:19234730-19234752 GAGATATTAACACAAATAGCAGG No data
1064813909_1064813915 28 Left 1064813909 10:19234697-19234719 CCTACTATACTCCAGACACTATG No data
Right 1064813915 10:19234748-19234770 GCAGGTGATCATTGTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064813909 Original CRISPR CATAGTGTCTGGAGTATAGT AGG (reversed) Intronic
No off target data available for this crispr