ID: 1064814669

View in Genome Browser
Species Human (GRCh38)
Location 10:19245971-19245993
Sequence ACTTAAATGCAGTCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064814667_1064814669 15 Left 1064814667 10:19245933-19245955 CCTATATTCTCTCTTTAAATTTC 0: 1
1: 0
2: 3
3: 55
4: 772
Right 1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG No data
1064814666_1064814669 16 Left 1064814666 10:19245932-19245954 CCCTATATTCTCTCTTTAAATTT 0: 1
1: 1
2: 3
3: 139
4: 1098
Right 1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064814669 Original CRISPR ACTTAAATGCAGTCAGTGGA AGG Intronic
No off target data available for this crispr