ID: 1064818764

View in Genome Browser
Species Human (GRCh38)
Location 10:19299268-19299290
Sequence ATGGAGAAGCAGAATTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064818764_1064818768 14 Left 1064818764 10:19299268-19299290 CCTTGGGAATTCTGCTTCTCCAT 0: 1
1: 0
2: 3
3: 22
4: 286
Right 1064818768 10:19299305-19299327 GCTATCAAATACAAAGTAAAGGG No data
1064818764_1064818770 18 Left 1064818764 10:19299268-19299290 CCTTGGGAATTCTGCTTCTCCAT 0: 1
1: 0
2: 3
3: 22
4: 286
Right 1064818770 10:19299309-19299331 TCAAATACAAAGTAAAGGGGTGG No data
1064818764_1064818769 15 Left 1064818764 10:19299268-19299290 CCTTGGGAATTCTGCTTCTCCAT 0: 1
1: 0
2: 3
3: 22
4: 286
Right 1064818769 10:19299306-19299328 CTATCAAATACAAAGTAAAGGGG No data
1064818764_1064818767 13 Left 1064818764 10:19299268-19299290 CCTTGGGAATTCTGCTTCTCCAT 0: 1
1: 0
2: 3
3: 22
4: 286
Right 1064818767 10:19299304-19299326 AGCTATCAAATACAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064818764 Original CRISPR ATGGAGAAGCAGAATTCCCA AGG (reversed) Intronic
900652871 1:3739166-3739188 ATGGAGAATCAGAATTCCTTGGG - Intergenic
902094329 1:13930285-13930307 ATGGAGAAGCAGCTTCCCCGGGG - Intergenic
902613594 1:17611189-17611211 ATGGAGCACCAGAAGGCCCAGGG + Intronic
902642967 1:17778521-17778543 TTGGTGAAGCAAAAATCCCAAGG + Intronic
903249400 1:22041665-22041687 ATGGAAAAGCAGGATGCTCAGGG - Intergenic
904259157 1:29278319-29278341 ATGGGGAAGCTGAAGTCCTAAGG - Intronic
904675447 1:32196406-32196428 AGGAAGAAGTAGAATCCCCAAGG - Exonic
905620550 1:39442183-39442205 ATGGAGAAGCTTAATCACCAGGG + Exonic
906002180 1:42436064-42436086 ATAGAGAAGGAGATTTCCAAGGG - Intronic
906841775 1:49147013-49147035 ATAGAGAAGCAGAAAAGCCAAGG + Intronic
908185126 1:61645189-61645211 AAGGAGGAGCAGATTTCCCGAGG - Intergenic
910312638 1:85842346-85842368 ATGGAGAACCAGGAATTCCAGGG - Exonic
910415040 1:86988592-86988614 ATTGAGGAGGAGGATTCCCAAGG - Intronic
910708008 1:90150151-90150173 ATAGAGAAGCACCTTTCCCAGGG + Intergenic
914216072 1:145629753-145629775 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914328280 1:146642200-146642222 ATGAGGAAGCTGAATTCTCATGG - Intergenic
914468641 1:147952406-147952428 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914956585 1:152168067-152168089 ATGATTAGGCAGAATTCCCATGG - Intergenic
916362503 1:163986446-163986468 AGGGAGAAGCACAGTTCCAAAGG - Intergenic
916385064 1:164257853-164257875 ATGGCGAAGAAGTTTTCCCAGGG + Intergenic
918277749 1:182970118-182970140 CTTGGGAAGCAGAATTCCTAAGG - Intergenic
918868842 1:189939362-189939384 ATGTTGAAGCCTAATTCCCAAGG - Intergenic
918996956 1:191773758-191773780 ATGGAGTTGCAGAAGACCCAGGG - Intergenic
919751723 1:201041875-201041897 ATGGAGAAGCAGGGTTCCAAAGG - Intronic
922145146 1:222935991-222936013 ATGGAGATGAAAAATTCCTATGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064114079 10:12562764-12562786 TTGGAGCAGCAGAGATCCCATGG - Intronic
1064818764 10:19299268-19299290 ATGGAGAAGCAGAATTCCCAAGG - Intronic
1067427821 10:46222825-46222847 ATGGAGACCGAGAAGTCCCATGG - Intergenic
1067450838 10:46380962-46380984 ATGGGGAGGCAGATTTCCTAAGG + Intronic
1067583241 10:47458717-47458739 ATGGAGACTGAGAAGTCCCACGG - Intergenic
1067586405 10:47478789-47478811 ATGGGGAGGCAGATTTCCTAAGG - Intronic
1067787514 10:49261274-49261296 ATGGAGAAGGAAAATTGGCAGGG - Intergenic
1068867773 10:61913314-61913336 ATGGTCAAGAAGAATTGCCATGG + Intronic
1068907849 10:62346522-62346544 ATGGAGAAGCAGATTTTCATAGG - Intergenic
1070574238 10:77665450-77665472 ATGAAATAGCAGAATTCCCAGGG - Intergenic
1072729842 10:97838260-97838282 AAGGAGAACCAGAGGTCCCAGGG - Intergenic
1073318372 10:102598894-102598916 ATGGAGAGGCAGAGTTTCCTGGG + Intronic
1074435937 10:113434401-113434423 ATGGAAAGGCAGAATTCAAACGG - Intergenic
1074875533 10:117610459-117610481 AGTGAGAAGCAGGACTCCCAGGG + Intergenic
1074895784 10:117776559-117776581 GTGGAGAGGCAGAATCCCAAGGG + Intergenic
1075401818 10:122166466-122166488 TTGGAGTAGCAGAAGTCCCATGG + Intronic
1076003939 10:126933053-126933075 CTGGACAAGCAGAAGGCCCAGGG + Intronic
1078880089 11:15439394-15439416 GGAGAGAAGCAGAATTCCCAAGG + Intergenic
1079384713 11:19968585-19968607 AAGGCAAAGCAGAATTCCCTAGG - Intronic
1079914345 11:26349959-26349981 ATGGAGGAGCAGATGTCCCCTGG + Intronic
1080763397 11:35274012-35274034 ATGGAGAACAAGGAGTCCCAAGG + Intronic
1080855875 11:36111200-36111222 AAGGATAAGCAGAATTCTCACGG - Intronic
1084792167 11:71481865-71481887 TCGGAGAAGCAGCATGCCCATGG - Intronic
1085183877 11:74559134-74559156 ATGGAAAAGGACATTTCCCAAGG - Intronic
1085876967 11:80419527-80419549 ATGGAGCAGAAAAATTCCTATGG + Intergenic
1088184583 11:107151237-107151259 ATGGAGAAGAAGAGTTCTCTTGG - Intergenic
1088220718 11:107567319-107567341 GTGCAGAAGCAGAATTGCAATGG - Intergenic
1089129605 11:116201298-116201320 ATGGAGAAGCAGGATTGCTGCGG + Intergenic
1089265530 11:117257452-117257474 ATTGAGAACAAGAATTCCAACGG - Intronic
1089440292 11:118510360-118510382 AGGGGGAAGCAGAGTTCTCAGGG - Intronic
1089610638 11:119666754-119666776 AGGGAGGAGCATGATTCCCATGG - Intronic
1090674219 11:128974188-128974210 CTGAAGAAGTAGAATTGCCAGGG - Exonic
1092503831 12:9074579-9074601 ACGAAGCAGCAGAATGCCCAGGG - Exonic
1092510844 12:9154635-9154657 ATGAAGCAGCAGAACGCCCAAGG - Exonic
1094006926 12:25763809-25763831 ATGGAAAAGCAAAAGACCCAGGG - Intergenic
1094474093 12:30827992-30828014 GTGGCGAAACAGAATTCCAAAGG - Intergenic
1095122159 12:38432513-38432535 ATGAAGAAGGAGGATTTCCAGGG - Intergenic
1097314836 12:58160889-58160911 ATGGAGAGGAGGAATTCCCTAGG + Intergenic
1099597185 12:84681935-84681957 ATGGAAACTCAGAAGTCCCATGG - Intergenic
1099750148 12:86762960-86762982 TTGAAGAAGCATAAATCCCATGG - Intronic
1100182688 12:92102448-92102470 ATGGAGCAGCAGAAGTGCAAGGG + Intronic
1101956271 12:109215115-109215137 AGGGAGAAGCAAAATTTACATGG + Intronic
1102029342 12:109731036-109731058 ATGGAGAAACTGAGTCCCCAAGG + Intronic
1102972448 12:117180491-117180513 CTGGAGAAGCAGAATTCTCCTGG - Intronic
1104389805 12:128382084-128382106 ATGGCGAAGCTGATTCCCCATGG + Intronic
1104647455 12:130507281-130507303 AGGGAAAAGCAGGATCCCCATGG + Intronic
1111539275 13:89650182-89650204 ATGCAGGAGGTGAATTCCCATGG + Intergenic
1112104765 13:96228961-96228983 ATGGAGAAGCAGAGGTCCTAAGG + Intronic
1112920759 13:104609590-104609612 ATGGACAAGCAGGATTCCCAGGG + Intergenic
1114620288 14:24092329-24092351 ATTGAGAAGTACAATTCCAAAGG + Intronic
1116584860 14:46690460-46690482 ATGGAGAAGCCTAATTCAAAAGG + Intergenic
1117878562 14:60282731-60282753 ATGGAAAAGCATAATGCCCAGGG + Exonic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118922857 14:70165948-70165970 TTGGAGAAGCAGAGCTCCCAGGG - Intronic
1119146121 14:72316005-72316027 ATGCATAGGCAGAATTCCCTGGG + Intronic
1119951692 14:78752064-78752086 AAGGACAAACACAATTCCCAAGG - Intronic
1122005308 14:98698592-98698614 ATGGAGATACAGAAGTCCCTGGG - Intergenic
1123203830 14:106692705-106692727 ATGAAGATTCACAATTCCCAGGG - Intergenic
1123924236 15:25092397-25092419 AGGGAGAAACTGAAATCCCATGG + Intergenic
1124972697 15:34504807-34504829 GAGGAGAAGAAGAAATCCCAAGG + Intergenic
1126364153 15:47876630-47876652 ATGGGAAAGGAGTATTCCCAAGG - Intergenic
1126781665 15:52144179-52144201 ATGCAGCGGAAGAATTCCCATGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127801855 15:62484001-62484023 GTGCAGCAGCTGAATTCCCAGGG + Intronic
1127901597 15:63345206-63345228 CTGGGGAGGCAGTATTCCCAGGG - Intronic
1128108791 15:65063293-65063315 AAGGACAAGGGGAATTCCCAAGG - Intronic
1128640017 15:69329074-69329096 AGGGCGAAGCCGCATTCCCAGGG - Intronic
1130726940 15:86448859-86448881 AAGGAGAAGCTGATTTCCGAAGG + Intronic
1132187707 15:99816855-99816877 GAGGAGAAGAAGAAATCCCAAGG - Intergenic
1133473535 16:6098237-6098259 ATGGAGAGGCAGCAGTGCCAAGG + Intronic
1135492539 16:22922372-22922394 ATGGAGAAGCAGGTATCACACGG - Intergenic
1136704472 16:32174644-32174666 ATGGAGGGGCAGAACACCCAGGG - Intergenic
1136763440 16:32754762-32754784 ATGGAGGGGCAGAACACCCAGGG + Intergenic
1136804660 16:33115624-33115646 ATGGAGGGGCAGAACACCCAGGG - Intergenic
1137702451 16:50506775-50506797 ATAGAGAAGCTGAAGCCCCATGG - Intergenic
1138680124 16:58678245-58678267 ATGGAGGAGCAGGGTTCCCCAGG + Intronic
1139339881 16:66261496-66261518 GTGCATATGCAGAATTCCCATGG - Intergenic
1139683395 16:68582798-68582820 AGGGAGAAGCAGCCTTCCCAGGG - Intergenic
1140005283 16:71068741-71068763 ATGAGGAAGCTGAATTCTCATGG + Intronic
1141367628 16:83457894-83457916 CTGGAAAAGCAAAATTCCCTGGG - Intronic
1141552244 16:84813803-84813825 ATCGAGAAACAAAAATCCCAGGG - Intergenic
1203065590 16_KI270728v1_random:1015083-1015105 ATGGAGGGGCAGAACACCCAGGG + Intergenic
1146587514 17:34095057-34095079 ATGGAGAAACTGAAGACCCAGGG - Intronic
1147879096 17:43642489-43642511 ATGGAGACCCAGAGGTCCCAGGG + Intronic
1148401325 17:47364198-47364220 ATAGAGAAGTAGAGTTGCCAAGG - Intronic
1148768436 17:50053122-50053144 ATGGAGAAAGAGAAATCTCAGGG - Intergenic
1149105665 17:52961559-52961581 ATGGAGGTGAAGAAGTCCCATGG - Intergenic
1149437602 17:56646377-56646399 ATGGGGAATCAGGATTCCTAGGG - Intergenic
1151780610 17:76242478-76242500 ATGGAGAAGCTGGCTTCCCAGGG - Intergenic
1156509588 18:37625318-37625340 AGGGAGAAGCAAAATCCTCATGG - Intergenic
1156776920 18:40801762-40801784 ATGGAGAAGATGAATTCTAAGGG + Intergenic
1157741246 18:50095432-50095454 GTGGAGAAGCAGAAATGTCACGG - Intronic
1158294038 18:55974279-55974301 ATGGTGAAGTAGAATATCCAAGG + Intergenic
1159057653 18:63482015-63482037 ATGGAGAAGGAGGAAGCCCATGG + Intronic
1159355505 18:67334227-67334249 ATAAAGAATGAGAATTCCCAGGG + Intergenic
1160671533 19:366938-366960 AAAGAGAAGCAGAAATCACAGGG - Intronic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1161409939 19:4111548-4111570 AAGGAGAGGGAGAATTCTCAGGG - Intronic
1161440319 19:4287807-4287829 ATGAAGAAGGACAATTCCCTTGG - Intronic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162828076 19:13266505-13266527 GAGGAGATGCAGAATGCCCATGG - Intronic
1164158224 19:22609566-22609588 ACAGAGAACCAGAATGCCCAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167798501 19:51726161-51726183 AGGGAGAAGGTGCATTCCCAAGG + Intergenic
1168651204 19:58093414-58093436 ATGGAGAAGCAGGATAGCTAGGG + Intronic
925378399 2:3405463-3405485 ATTGAAAAGCGTAATTCCCACGG - Intronic
926812010 2:16763662-16763684 ATGGAGAAGCTGGAGTCCCTTGG + Intergenic
927242445 2:20930700-20930722 AATGTGAAGGAGAATTCCCAGGG - Intergenic
927720694 2:25380014-25380036 ATGGAGCAGAAGCATTCCCCAGG + Intronic
928342729 2:30459255-30459277 AGGGAGAAGCAGAAGCTCCAAGG + Intronic
929822959 2:45288122-45288144 ATGGAGAAGCAGAGAAGCCAGGG - Intergenic
929979900 2:46668650-46668672 GTGGAGAAGCAGGAGTCGCAAGG - Intergenic
931912600 2:66917857-66917879 ATGGGGATGCATAATTCCAATGG + Intergenic
932038558 2:68274019-68274041 ATGGAGAAGGAAAAATCCTAAGG + Intergenic
932099061 2:68879970-68879992 TTGGAGGACCAGGATTCCCATGG - Intergenic
932254273 2:70270405-70270427 ATGGAGGAGCAGATTTCCAGAGG + Intronic
932874737 2:75439289-75439311 GTGAAGTAGCAGAGTTCCCAGGG - Intergenic
932910139 2:75797927-75797949 ATGGAGGCCCAGAAGTCCCACGG + Intergenic
933471038 2:82723897-82723919 ATTCAGAAGCATAATTTCCATGG - Intergenic
933496344 2:83054331-83054353 AAGGGCAAGCAGAATCCCCAAGG + Intergenic
935341318 2:102062116-102062138 CTGGAGAAGCTGAAGTCCCAGGG - Intergenic
936932412 2:117803856-117803878 ATGGAGATGCAGAAATCAGATGG - Intergenic
939561661 2:143739498-143739520 ATGATGATGCAAAATTCCCAAGG - Intronic
941189921 2:162368837-162368859 ATGATGAAGCACAATTCTCATGG - Intronic
942779378 2:179623316-179623338 ATGAAGGTGCAGAATTCCTAGGG - Intronic
944020046 2:195091745-195091767 ATGGATAAGGAAAATTTCCAAGG + Intergenic
947192527 2:227522548-227522570 ATGGAGAGGCAGAGTTGCCTAGG - Intronic
947380080 2:229536861-229536883 TTGGGGAAAGAGAATTCCCATGG - Intronic
947480964 2:230499674-230499696 ATGAAGAAGCACGATTCCCATGG - Intronic
947723283 2:232381805-232381827 ATGGGGAAGCAGGAGCCCCAGGG - Exonic
947727627 2:232409882-232409904 ATGGGGAAGCAGGAGCCCCAGGG - Exonic
948069369 2:235107181-235107203 AGGGAGATGCAGCATTCTCAGGG - Intergenic
1168966386 20:1900943-1900965 ATGGTGAAGCAGCTTGCCCAAGG + Intronic
1170585943 20:17734111-17734133 ATGGAGGAAGGGAATTCCCAAGG - Intronic
1172087714 20:32400764-32400786 ATGCAGAAGCAGAAGCCCTATGG - Intronic
1173710857 20:45154295-45154317 ATGGACATGCAGAAGACCCAAGG - Intergenic
1174525160 20:51164694-51164716 AGGGAGAAGCAGCTTGCCCAAGG - Intergenic
1175370325 20:58483899-58483921 CTGGAGAGGCAGAGTCCCCAGGG + Intronic
1176378110 21:6096782-6096804 AGGGAGAAGCAGTGTTACCAGGG + Intergenic
1177097283 21:16851879-16851901 TTGGAGAAGTAGTTTTCCCAAGG + Intergenic
1179143511 21:38748139-38748161 ATGGAGAAGCAGAACCCACCAGG - Intergenic
1179731537 21:43370623-43370645 CTGGAGAAGCAGAAACCCCCAGG - Intergenic
1179745363 21:43441464-43441486 AGGGAGAAGCAGTGTTACCAGGG - Intergenic
1181893085 22:26081917-26081939 GTTGAGAAGCAAAATGCCCAGGG + Intergenic
1181991477 22:26840099-26840121 GTGGAGAAGCAGGATTACCGTGG + Intergenic
1182022368 22:27091571-27091593 CTGGAGAAGCTGCATTCACAGGG + Intergenic
1183213183 22:36463639-36463661 ATGGAAAAGCAGCCTGCCCAAGG + Intergenic
1184819009 22:46894644-46894666 ATGGAGAACGAGAATCCTCAAGG + Intronic
950126474 3:10512953-10512975 ATGGAGAAGCAGGAAGCACATGG - Intronic
951603994 3:24411456-24411478 ATGGCAAAGCAGAATGCCCTGGG + Intronic
952410597 3:33046693-33046715 ATGGATCAGCAGAAAACCCAGGG + Intronic
953360412 3:42290770-42290792 AGGGAGAAGGAGAATCTCCAGGG - Intergenic
954494371 3:50940411-50940433 ATGGAGAGGCAGTATGCTCACGG + Intronic
954695394 3:52421966-52421988 TTGGGGAATCAGAATTCCCTGGG + Intronic
954772742 3:52987437-52987459 ATGGAGATGAAAAATTCCTATGG - Intronic
954820317 3:53320956-53320978 AGGGAGACGCAGAAGTCCCCTGG + Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
955987601 3:64590848-64590870 AAGGAGAAGCACAGTTTCCAAGG + Intronic
956203509 3:66732061-66732083 ATGCAGAATCAGAATTCACAGGG - Intergenic
959334007 3:105041253-105041275 ATGCTGAAACCGAATTCCCAAGG + Intergenic
959688942 3:109177648-109177670 CTGGAGAAACACAGTTCCCAGGG + Intergenic
961180007 3:124869074-124869096 CTGGAGCAGGAGAATCCCCATGG + Intronic
961911159 3:130317933-130317955 ATGGTGTAGCAGAATTGCAATGG - Intergenic
961953731 3:130778189-130778211 ATGAAGAAGCAGAATTTCTGGGG - Intergenic
966629101 3:182052052-182052074 ATGGAGAATCGGCTTTCCCAAGG + Intergenic
967619534 3:191616204-191616226 ATGGAGAAGCAGATTTCCTAAGG - Intergenic
968869102 4:3232357-3232379 ATGGGGACACAGAATTCCCATGG - Intronic
969136484 4:5033313-5033335 AGGGAGAAGCAGGGTTTCCACGG - Intergenic
969525165 4:7700619-7700641 TTGGAGAAGCACAATGCCTATGG - Intronic
970137627 4:12943214-12943236 ATGATGAAGCAGAATGGCCATGG - Intergenic
970765300 4:19541144-19541166 ATGGTAAAGCAGAATTCAGAAGG - Intergenic
971143230 4:23947686-23947708 ATGGAGAAGCATGATCTCCATGG - Intergenic
972151229 4:36093568-36093590 AAGGTTAAGCAGATTTCCCAAGG + Intronic
972197351 4:36670233-36670255 AGAGAGAAGAAGAATTCCCTGGG + Intergenic
972342492 4:38164606-38164628 ATGGAGAGGAAGCATACCCATGG - Intergenic
972414130 4:38821946-38821968 ATGGAGATGAAAAATTCCTATGG + Intronic
972983785 4:44739156-44739178 AAAGACAAGCACAATTCCCATGG - Intergenic
973721679 4:53730602-53730624 TTGGAGATCCAGGATTCCCACGG - Intronic
973824422 4:54691103-54691125 GTGGAGCAGCAGAATTGACATGG + Intronic
974117148 4:57592902-57592924 ATGAAGATGCATAATGCCCAGGG + Intergenic
974298671 4:60036710-60036732 ATGGAGACTGAGAAGTCCCATGG - Intergenic
974468462 4:62288385-62288407 ATGAAGAAACAGAGTGCCCAGGG - Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
976225029 4:82789116-82789138 ATAGACAAGCTGGATTCCCAAGG + Intronic
976472981 4:85451204-85451226 ATGGTTAAGCAAATTTCCCAAGG - Intergenic
976575743 4:86668943-86668965 AGTGAGAAACAGAATTACCAAGG - Intronic
977586017 4:98775956-98775978 AGGAAGAAGCAGAACTGCCATGG - Intergenic
977586090 4:98777128-98777150 AGGAAGAAGCAGAACTGCCATGG - Intergenic
979216421 4:118170038-118170060 AGGCAGAAGCAGAATTGCCTTGG + Intronic
979607187 4:122651049-122651071 CTGGAGAAAGAGAATTTCCAGGG - Intergenic
980481853 4:133397676-133397698 ATTGAGAAGAAAAACTCCCAAGG - Intergenic
983187996 4:164722721-164722743 TTGGAGAAGGACAATTACCATGG - Intergenic
984553999 4:181192439-181192461 ATGGAGGGTAAGAATTCCCAAGG + Intergenic
984637940 4:182133954-182133976 ATAGGGAATCAGAATCCCCAAGG - Intergenic
985182057 4:187275492-187275514 ATGGAAAAGCGAAATTCCCTAGG + Intergenic
985191179 4:187374895-187374917 AAGGACATCCAGAATTCCCATGG + Intergenic
985211310 4:187598483-187598505 ATCGTGAAGCTGTATTCCCATGG - Intergenic
986235455 5:5905542-5905564 ATAGACAAGCAGGATGCCCATGG - Intergenic
986937116 5:12902900-12902922 ATGCAGCAGCAAAATTCCAAAGG + Intergenic
987794107 5:22605878-22605900 ATGGAGATGCAGATGACCCATGG - Intronic
988103804 5:26716994-26717016 ATGGAGAAGCGTAAATCCCAAGG - Intergenic
989426765 5:41304604-41304626 ATAGACAAGCCAAATTCCCATGG + Intergenic
990797151 5:59556465-59556487 ACAGCAAAGCAGAATTCCCAAGG - Intronic
990808330 5:59692346-59692368 ATAGCAAAGCAGAATTCCAAGGG + Intronic
990987171 5:61651516-61651538 ATGGTAAAGAAGGATTCCCAAGG - Intronic
993332189 5:86614733-86614755 ATGGAGAAGCCACATTACCAGGG - Intergenic
994290342 5:98022667-98022689 ATGGAGATGCAGAAATCACCCGG - Intergenic
995605483 5:113850102-113850124 AGGGAAAAGAAGAATTTCCATGG + Intergenic
995654599 5:114411398-114411420 ATGGAGACTGAGAAGTCCCAAGG + Intronic
996270256 5:121596247-121596269 AAGGGGAAGCAGAAGTCCAAAGG + Intergenic
998314044 5:141163548-141163570 ATGGAGAAGAATAAATCGCAGGG - Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
999552271 5:152702361-152702383 ATGGAGATGAAAATTTCCCAGGG - Intergenic
1002308979 5:178302849-178302871 ATGGAAAAGCACCATACCCAAGG - Intronic
1002698361 5:181105056-181105078 ATGGAGCTGAAGAATTCCTATGG + Intergenic
1002708537 5:181179852-181179874 ATGGAGCTGAAGAATTCCTATGG - Intergenic
1003077693 6:2997848-2997870 ATGAAGAAGCAGTTTTCCAAAGG + Intronic
1003454151 6:6265316-6265338 ATGGGGCAGGAGACTTCCCATGG - Intronic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1004782112 6:18920780-18920802 ATGGAGAATGAGAAGTTCCACGG + Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1008434554 6:51460206-51460228 AGGGAGATGCACAATCCCCAAGG - Intergenic
1011989327 6:93493392-93493414 ATGGAGAAGGAGGATACACATGG - Intergenic
1012161999 6:95897292-95897314 ATGGAAACTGAGAATTCCCATGG - Intergenic
1014311739 6:119812293-119812315 ATGGAAAAGCAGATTTATCATGG - Intergenic
1016937874 6:149461353-149461375 AAGAAGAAGAAGAATTCCCTGGG + Intronic
1017233484 6:152096603-152096625 AAGTAGAAGCCGAATTCACAGGG - Intronic
1017380073 6:153817924-153817946 ATGAAGAAGCAGAATCTTCAGGG + Intergenic
1017889671 6:158628007-158628029 AAGGAGAAGCAGGCTTCCCTCGG + Intronic
1020743817 7:12055676-12055698 ATGGCCAAGTAGATTTCCCAAGG - Intergenic
1022925845 7:35055526-35055548 ATGGAGCAGCGGAATAGCCAGGG - Intergenic
1022949766 7:35326377-35326399 ATGAACAAGCATAATTCCCATGG + Intergenic
1023244415 7:38185738-38185760 AAACAGAAGCTGAATTCCCAGGG - Intronic
1024227272 7:47335542-47335564 TGGGAAAAGCAGGATTCCCAGGG + Intronic
1025868571 7:65408541-65408563 AGGGAGAAATAGAATTACCAGGG + Intergenic
1027462801 7:78476572-78476594 ATTTAGAACCACAATTCCCAAGG - Intronic
1027463063 7:78479213-78479235 ATTTAGAACCACAATTCCCAAGG - Intronic
1027549609 7:79574381-79574403 ATGTAAAAGGTGAATTCCCATGG - Intergenic
1027677038 7:81172767-81172789 ATAGCAAAGCAGAATTCCAATGG - Intergenic
1028721942 7:94043054-94043076 AAGGAGAAGAAGAATTTGCAGGG - Intergenic
1031080332 7:117251573-117251595 ATGAAGGAGGAGAGTTCCCAGGG - Intergenic
1032904952 7:136353862-136353884 ATGGAGAAGCAGCTGTACCAGGG + Intergenic
1034564329 7:151901193-151901215 ATGGCGATGCATAATTACCAGGG - Intergenic
1036208716 8:6824873-6824895 ATGGAGAGGCAGTCTTTCCAAGG + Intronic
1036250072 8:7154560-7154582 ATTGAGGGGGAGAATTCCCAAGG + Intergenic
1036827971 8:11993560-11993582 TTAGAGAAGCAGATTTGCCATGG - Exonic
1037543994 8:19899903-19899925 TGGGAGAAGCAGCATTGCCAAGG + Intergenic
1040139901 8:43897571-43897593 ATCGAGGAGTAGGATTCCCAAGG - Intergenic
1040353096 8:46588115-46588137 ATTGAGGAGGAGGATTCCCAAGG - Intergenic
1040670226 8:49680760-49680782 ATGGGGAAGTAGAATTAACAGGG + Intergenic
1040723697 8:50356085-50356107 ATGGAAAATCAGAATTGCAAGGG - Intronic
1040879358 8:52188906-52188928 TTGCAGAAGCAGGATTCACAAGG + Intronic
1041098988 8:54377969-54377991 ATGGAGAAGCAGATATGCCAGGG - Intergenic
1041478475 8:58292244-58292266 ATGGAGAAGGAAGAATCCCAAGG - Intergenic
1041947759 8:63465581-63465603 ATTCAGAAGCATAATTTCCACGG - Intergenic
1043225216 8:77719014-77719036 AAGGAGAAGCAGAATTTCCAAGG + Intergenic
1043910091 8:85854236-85854258 ATGGAGGCTGAGAATTCCCATGG + Intergenic
1045017781 8:98013740-98013762 ATCCAGAAGCAGAATTGCCTAGG - Intronic
1045286450 8:100795946-100795968 AGTGAGGAGCAGAATTCCTAAGG + Intergenic
1045648778 8:104324158-104324180 ATGAACCAGCAGAATTCCCAGGG - Intergenic
1047569716 8:126084597-126084619 ATGGAAAGGCACAATGCCCAGGG + Intergenic
1047822906 8:128540874-128540896 TTGGAGATGCAGAAACCCCAGGG - Intergenic
1047905718 8:129471162-129471184 ATGGAGACTGAGAAGTCCCAAGG + Intergenic
1048219531 8:132528749-132528771 ATGAAGAAGCAGAGCTTCCAAGG + Intergenic
1048859870 8:138716269-138716291 AGGGAGAAGCAGGCCTCCCAGGG - Exonic
1049205107 8:141360025-141360047 CTGGGACAGCAGAATTCCCAGGG - Intronic
1049444836 8:142625093-142625115 ATGGAAAACCTGACTTCCCAGGG - Intergenic
1055888864 9:81100845-81100867 ATGGATAAGCTGAAATCCCACGG - Intergenic
1057134896 9:92680643-92680665 AAGGAGAAGCAGAGTCCCCCAGG + Intergenic
1057448857 9:95138431-95138453 ATGGGGAAGCAGAACACCCCTGG + Intronic
1058292213 9:103256838-103256860 CTGCAGAAGCAGAGTTCTCATGG - Intergenic
1059770829 9:117423420-117423442 ATGGCAAAGGAGGATTCCCACGG + Intergenic
1060052989 9:120390331-120390353 AAGGAGAAGCAGCATGCCCACGG - Intronic
1060206084 9:121683562-121683584 ATGGAGAAGGAGAAGTGTCAGGG + Intronic
1061212918 9:129203803-129203825 AAGGGGAAGGAGACTTCCCAGGG + Intergenic
1186445042 X:9620135-9620157 ATGGAGAAGTAGAAGCCACACGG - Intronic
1187570526 X:20496276-20496298 AAGGAGAAGCACAAGACCCAGGG + Intergenic
1189137756 X:38566596-38566618 ATGGAATAGCAGATTTCACAAGG + Intronic
1190232633 X:48594211-48594233 ATGGTGAAACAGAATTTCCCAGG + Intronic
1190517543 X:51240284-51240306 TTGGAAATGCAGAAGTCCCATGG + Intergenic
1197881617 X:131172464-131172486 GAGGAGAAGCAGTATGCCCAAGG + Intergenic
1199440413 X:147861595-147861617 ATGGAGACCTAGAAATCCCATGG - Intergenic
1199714846 X:150500172-150500194 AAAGAGAGGCAGAATTTCCAGGG + Intronic
1200757309 Y:7001935-7001957 ATGGAGAAGTAGAAGCCACATGG - Intronic