ID: 1064818866

View in Genome Browser
Species Human (GRCh38)
Location 10:19300684-19300706
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6700
Summary {0: 1, 1: 0, 2: 27, 3: 500, 4: 6172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064818866 Original CRISPR TGGTTTTTGAATATGGAGTA AGG (reversed) Intronic
Too many off-targets to display for this crispr