ID: 1064818958

View in Genome Browser
Species Human (GRCh38)
Location 10:19301836-19301858
Sequence GGTTCAATGGGTCCATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 82, 4: 467}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064818958_1064818963 -4 Left 1064818958 10:19301836-19301858 CCTGCCCATGGACCCATTGAACC 0: 1
1: 0
2: 4
3: 82
4: 467
Right 1064818963 10:19301855-19301877 AACCTAAAATAAAACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064818958 Original CRISPR GGTTCAATGGGTCCATGGGC AGG (reversed) Intronic
900007564 1:73031-73053 GGTTCAGAGGGTACATGTGCAGG + Intergenic
900323779 1:2097489-2097511 GGCTCACCGGGTCCAAGGGCAGG - Intronic
900498118 1:2985755-2985777 GGATCAATGGATCAATGAGCTGG - Intergenic
901284848 1:8069496-8069518 GGTTCAAGGGATACATGGTCAGG + Intergenic
901950247 1:12739432-12739454 GGTTCAAGGGGTGAATGTGCAGG - Intergenic
902127357 1:14227022-14227044 GGTTCAAGGGGTAAATGTGCAGG - Intergenic
903023747 1:20412305-20412327 GATTCAAGGGGTACATGTGCAGG + Intergenic
903564007 1:24250797-24250819 GGTTCTATGGCACCTTGGGCAGG - Intergenic
904640887 1:31927485-31927507 GGTTCAGTGTGTACATGTGCAGG - Intronic
904751573 1:32743754-32743776 GGTTCATTGGGTCAGTGGCCAGG + Intronic
904761377 1:32806923-32806945 GATTCAAGGGGTGCATGTGCAGG - Intronic
907360366 1:53909118-53909140 AGTTCACTGGTTCCATGGCCGGG + Intronic
907793235 1:57689036-57689058 GATACAATGGGTACATGTGCAGG - Intronic
908105829 1:60840968-60840990 GGTTCAAGGGGTAGATGAGCAGG - Intergenic
910274877 1:85438298-85438320 GGTTCAGGGGGTCCATGTTCAGG - Intronic
910313284 1:85852987-85853009 GGTTCAAGGGGTACATGTGCAGG + Intronic
911393971 1:97282597-97282619 GGTTCAAGGGGTACATGTGCAGG + Intronic
911908971 1:103607188-103607210 GGTTCAGGAGGTACATGGGCAGG - Intergenic
911913948 1:103672273-103672295 GGTTCAGGAGGTACATGGGCAGG + Intronic
911990202 1:104686526-104686548 GGTTCAGGGGGTGCATGTGCAGG + Intergenic
912487823 1:110043037-110043059 GGGTCAATGTGTCCACAGGCTGG - Intronic
912590766 1:110817469-110817491 GGTTCAGGGGGTACATGTGCAGG + Intergenic
913383882 1:118239017-118239039 GGTAAAATGGTTTCATGGGCCGG + Intergenic
913588448 1:120299523-120299545 GGTTCAGGGGGTACATGTGCAGG - Intergenic
913619737 1:120598846-120598868 GGTTCAGGGGGTACATGTGCAGG + Intergenic
914407621 1:147391787-147391809 GATTCAAGGGGTACATGTGCAGG - Intergenic
914570465 1:148911396-148911418 GGTTCAGGGGGTACATGTGCAGG - Intronic
914602365 1:149218873-149218895 GGTTCAGGGGGTACATGTGCAGG + Intergenic
915697685 1:157760921-157760943 GGTTCAAGAGGTACATGTGCAGG - Intronic
915707146 1:157855565-157855587 GGTTCAAGGGGTACATGTGCAGG - Intronic
915812776 1:158932427-158932449 GGTTCAGAGGGTACATGTGCAGG - Intronic
916665261 1:166961127-166961149 GGTTCAAGGAGTACATGTGCAGG + Intronic
916807600 1:168274069-168274091 GGCTCAAGGGGTACATGTGCAGG + Intergenic
916997993 1:170322204-170322226 GGTTCAAGTGGTACATGTGCAGG + Intergenic
917216489 1:172683656-172683678 GGTTCAGGGGGTACATGTGCTGG + Intergenic
918669797 1:187200811-187200833 GGTTCAAGGAGTACATGTGCAGG - Intergenic
919195412 1:194278656-194278678 GGTGCAGAGGGTACATGGGCAGG - Intergenic
919617531 1:199826086-199826108 GGTTCAGGGGGTACATGTGCAGG - Intergenic
919695505 1:200570769-200570791 GGTTCAAGGGGTACATGTGCAGG + Intronic
920413207 1:205778747-205778769 GGTTCAAGGGGTACATGTGCAGG + Intergenic
920889358 1:209968762-209968784 GATTCAAGGGGTACATGTGCAGG + Intronic
921236636 1:213138376-213138398 GGTTCAAGGGGTATATGTGCAGG + Intronic
922114423 1:222597775-222597797 GTTTCAGTGGGTACATGCGCAGG + Intergenic
922217049 1:223528407-223528429 GGTTTAATGGGGCAATGGACAGG - Intergenic
922786407 1:228284648-228284670 GCTTTAGTGGGTCCATGGCCAGG + Intronic
923282350 1:232456075-232456097 GGTTCAAGGGGTACATGTGCAGG - Intronic
923425522 1:233865080-233865102 GATTCAGGGGGTACATGGGCAGG - Intergenic
923824993 1:237490304-237490326 GATTCAAGGGATACATGGGCAGG - Intronic
924311137 1:242744278-242744300 GAATCAGTGGGTCAATGGGCTGG + Intergenic
1062920829 10:1278323-1278345 GGTTCAGTGGGTACATGTGCAGG + Intronic
1063625406 10:7685056-7685078 GCTTCAGTGGGTACATGTGCAGG - Intergenic
1063859983 10:10296405-10296427 GATTCCAAGGGTCCATGTGCAGG + Intergenic
1063872598 10:10434802-10434824 GGTTCAAGGGGTACATGTGTGGG - Intergenic
1064525772 10:16255036-16255058 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1064818958 10:19301836-19301858 GGTTCAATGGGTCCATGGGCAGG - Intronic
1065760113 10:28974152-28974174 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1065963850 10:30754964-30754986 GAGTCAGTGGGTACATGGGCTGG - Intergenic
1066097613 10:32087166-32087188 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1066496263 10:35945101-35945123 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1067368020 10:45654286-45654308 GGTTCAGTGGATACATGGGTAGG - Intronic
1068200452 10:53777010-53777032 GGTTCAAGAGGTACATGTGCAGG - Intergenic
1069046340 10:63747501-63747523 GATTCAAGGGGTACATGTGCAGG - Intergenic
1069337353 10:67368009-67368031 GATTCAAGGGGTACATGCGCAGG - Intronic
1069458116 10:68569989-68570011 GGTTCAGGGGGTACATGTGCAGG + Intronic
1069583421 10:69580320-69580342 GGCTCAAGGGGTACATGTGCAGG + Intergenic
1071670797 10:87607784-87607806 GGTTCGGTGGGTACATGTGCAGG + Intergenic
1073582118 10:104678126-104678148 GCTTCAATGGGTCTATGCCCAGG - Intronic
1073621160 10:105049932-105049954 GAATCAATGGGTACATGTGCAGG - Intronic
1074073051 10:110092694-110092716 GGTTCAGGGGGTACATGTGCAGG - Intronic
1074500609 10:114020589-114020611 GGATCAATGGTTGCTTGGGCCGG + Intergenic
1074557561 10:114505883-114505905 GGTCCAAGGGGTACATGTGCAGG + Intronic
1074566535 10:114584089-114584111 GATTCAGTGGGTACATGTGCAGG - Intronic
1079465502 11:20725771-20725793 GATTCAGGGGGTCCATGTGCAGG + Intronic
1079863998 11:25712057-25712079 GATTCAGTGGGTACATGTGCAGG - Intergenic
1080246945 11:30189854-30189876 GTTTCAATGAGTACATGTGCAGG + Intergenic
1080423281 11:32132347-32132369 GGTTCAGTGGGTACATGTGCAGG - Intergenic
1081362493 11:42197601-42197623 GGTTCAGTAGGTACATGTGCAGG - Intergenic
1081426462 11:42931428-42931450 GGTTAAATGAGGCCATGGACTGG + Intergenic
1081822576 11:46014029-46014051 GATTCAAGGGGTACATGTGCAGG + Intronic
1081842203 11:46210736-46210758 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1082217988 11:49597902-49597924 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1082869249 11:57928909-57928931 TCTTCAATGGGTCCATGAGCTGG + Intergenic
1083022389 11:59520263-59520285 GGTTCAACGGGTGCATGTGTAGG - Intergenic
1083296452 11:61718041-61718063 GGTTCCATGGGTCCAAGGGTGGG + Intronic
1083573574 11:63772986-63773008 GCTTCAGTGGCTCCTTGGGCAGG + Intergenic
1083794266 11:65005635-65005657 GGTTAAAAGGGTCCCTGGTCGGG + Intergenic
1083865886 11:65452601-65452623 GATTCAGGGGGTCCATGTGCAGG + Intergenic
1084926451 11:72516866-72516888 GGTTCAGGGGGTCCATGTGCAGG - Intergenic
1085289276 11:75385954-75385976 ATTTCAATGGGTCACTGGGCTGG + Intergenic
1086076301 11:82856657-82856679 GGTTCAGGGGGTACATGTGCAGG - Intronic
1086631583 11:89026286-89026308 GGTTCAGGGGGTACATGTGCAGG - Intronic
1087669537 11:101089150-101089172 GCTTCAGTGGGTACATGTGCAGG - Intronic
1087692123 11:101332874-101332896 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1087815020 11:102648796-102648818 GGTTCATGGGGTACATGTGCAGG + Intergenic
1087986814 11:104692429-104692451 GATTCAAAGGGTACATGTGCAGG + Intergenic
1088120820 11:106367180-106367202 GGTTCAGGGGGTGCATGTGCAGG + Intergenic
1088187075 11:107182328-107182350 GATTCAAGGGGTACATGTGCTGG - Intergenic
1088809243 11:113379160-113379182 GATTCAGTGGGTGCATGTGCAGG + Intronic
1089069121 11:115685516-115685538 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1089894259 11:121912365-121912387 GGTTCAAGGGGTACATGTTCAGG - Intergenic
1091729681 12:2871173-2871195 GGTTCAGGGGGTACATGTGCAGG - Intronic
1092441091 12:8505038-8505060 GGTTCAAGGGGTACATGTGAAGG + Intergenic
1092500018 12:9036115-9036137 GGTTCAGTGGGTACATGTGCAGG - Intergenic
1092906694 12:13106814-13106836 GATTCAGTGGGTACATGTGCAGG + Intronic
1092943251 12:13429730-13429752 GGTTCAGTGGGTAGATGGGCAGG + Intergenic
1093198179 12:16153962-16153984 GATTCAAGGGGTACATGTGCAGG - Intergenic
1093497014 12:19769688-19769710 GGTTCAAGGGGTACATGTGCTGG - Intergenic
1093598545 12:20992337-20992359 GGTTCGGTGGGTACATGTGCAGG + Intergenic
1094397231 12:30020913-30020935 GATTCAAGGGGTGCATGTGCAGG - Intergenic
1095413487 12:41949074-41949096 GATTCAAGGGGTACATGTGCAGG - Intergenic
1095897490 12:47294602-47294624 GATTCAAGGGGTGCATGTGCAGG + Intergenic
1095936465 12:47688458-47688480 GATTCAAAGGGTACATGTGCAGG - Intronic
1096007657 12:48185283-48185305 GGTTCCAAGGGCCCCTGGGCTGG + Exonic
1097319945 12:58214308-58214330 GGTTCAAAGGGTACATGTGCAGG + Intergenic
1098057917 12:66527941-66527963 GGTTCAAGGGGTACATGTTCAGG - Intronic
1098399769 12:70062050-70062072 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1098902729 12:76129773-76129795 GGTTCAAGGGGTACATGTGCGGG + Intergenic
1098989926 12:77054199-77054221 AGTTCAGTGGGTACATGTGCAGG - Intronic
1099995101 12:89769793-89769815 GGATCACTTGGTCAATGGGCTGG + Intergenic
1100811998 12:98347812-98347834 GATTCACGGGGTCCATGTGCAGG + Intergenic
1100938397 12:99696064-99696086 GATTCAAGGGGTACATGTGCAGG - Intronic
1101533693 12:105597845-105597867 GGTTCAGGGGGTCCATGTGCAGG - Intergenic
1103959368 12:124599033-124599055 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1104239666 12:126975772-126975794 GGTTCAAGGGTTACATGTGCAGG - Intergenic
1104942574 12:132401895-132401917 GGATCAATGGGTGGATGGGTGGG - Intergenic
1105446229 13:20459816-20459838 GGTTCAAGGGGTACATATGCAGG - Intronic
1105727566 13:23179894-23179916 GGTTCGAGGGGTACATGTGCAGG + Intergenic
1107345922 13:39460852-39460874 GGTTCAGGGGGTGCATGTGCAGG + Intronic
1107568313 13:41629306-41629328 GGTTCAGAGGGTACATGTGCAGG - Intronic
1107676222 13:42800020-42800042 GATTCAAGGGGTACATGTGCAGG - Intergenic
1107892190 13:44923852-44923874 TCTTCAATAGGTCCATGGCCAGG + Intergenic
1108014786 13:46063184-46063206 GGTTCAGGGGGTACATGTGCAGG + Intronic
1108041758 13:46345861-46345883 TGCTCAATGTGTGCATGGGCAGG - Intronic
1108111510 13:47078746-47078768 GGTTCAGTGGGTACATGTGCAGG - Intergenic
1108529334 13:51314421-51314443 GGTTCAAGGGGTACATATGCAGG - Intergenic
1108807790 13:54181298-54181320 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1108979837 13:56496974-56496996 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1109254931 13:60068518-60068540 GGTTCAAGGGATACATGTGCAGG + Intronic
1109932036 13:69228612-69228634 GGTTCAAGTGGTACATGTGCAGG + Intergenic
1110049660 13:70879733-70879755 GATTCAGTGGGTACATGTGCAGG - Intergenic
1110421158 13:75310662-75310684 GGTTGAAGGGGTCCATGTGCAGG + Intronic
1110996829 13:82120714-82120736 GGTTCAAGGAGTACATGTGCAGG - Intergenic
1112683147 13:101790438-101790460 GATTCAGTGGGTACATGTGCAGG + Intronic
1114684544 14:24515983-24516005 GATTCAGTGGGTACATGTGCAGG + Intergenic
1114763670 14:25346366-25346388 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1114876300 14:26723930-26723952 GGTTCAAGGGGTTCATGTGTGGG + Intergenic
1115241274 14:31252906-31252928 GGCTCAGTGGCTCCATGGACAGG + Intergenic
1115463507 14:33688099-33688121 GGTTCAGAGGGTACATGTGCAGG + Intronic
1116024735 14:39501462-39501484 GGTTCAAGGGGTGCAGGTGCAGG + Intergenic
1116195487 14:41719993-41720015 GATTCAAGGGGTACATGTGCAGG + Intronic
1116240158 14:42331081-42331103 GGTTCAATGGGTATATCTGCAGG + Intergenic
1116283387 14:42939618-42939640 GATTCAAGGGGTACATGTGCAGG - Intergenic
1116305098 14:43243572-43243594 GATTCAAAGGGTACATGTGCAGG + Intergenic
1116723102 14:48526310-48526332 GGTTCATGGGGTACATGTGCAGG + Intergenic
1117648389 14:57877024-57877046 GGTTCAGTGGGTACATGTGCAGG + Intronic
1118504267 14:66393428-66393450 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1118651764 14:67903770-67903792 GGTTCAGGGGGTACATGTGCAGG + Intronic
1118761225 14:68881332-68881354 GGTTCAGTGGGTCCCTGAGATGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119943935 14:78671529-78671551 GTTTCAGAGGGTCCATGTGCAGG - Intronic
1120184560 14:81380946-81380968 GATTCAAGGGGTACATGTGCAGG - Intronic
1120246680 14:82014636-82014658 GATTCAAAGGGTACATGTGCAGG - Intergenic
1120509451 14:85395954-85395976 GATTCAGTGGGTCCTTGCGCAGG - Intergenic
1120818122 14:88884298-88884320 GGAAAAATGGTTCCATGGGCTGG - Intergenic
1120831556 14:89001691-89001713 GGTTCTATGGCTCCAAGGGAAGG - Intergenic
1123780580 15:23623024-23623046 GGTTCAAGGGGTACATGTGCAGG + Intronic
1123796143 15:23772718-23772740 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1124153406 15:27203065-27203087 GGTTCAAAGGATACATGTGCAGG + Intronic
1125061647 15:35432992-35433014 GGTTTAGTGGGTACATGTGCAGG - Intronic
1125366780 15:38926091-38926113 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1126993325 15:54409395-54409417 GGTTCAGTGGGTACATAGGCAGG + Intronic
1128363442 15:66979471-66979493 GATTCAGTGGGTACATGTGCAGG + Intergenic
1129438694 15:75562951-75562973 GGTTCAGGGGGTACATGTGCAGG + Intronic
1130782481 15:87057023-87057045 GCTTCAAGGGGTACATGTGCAGG - Intergenic
1131304802 15:91232742-91232764 GATTCAGTGGGTACATGTGCAGG + Intronic
1132200495 15:99951114-99951136 GGGTCACTGGCTGCATGGGCAGG - Intergenic
1132445986 15:101919081-101919103 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1133426309 16:5693198-5693220 GGGTTAAAGGGCCCATGGGCAGG - Intergenic
1135347122 16:21698620-21698642 GGGTCAATGGGTCCTTGAACAGG - Intronic
1135790010 16:25385272-25385294 GATTCAGTGGGTACATGTGCAGG + Intergenic
1135891049 16:26357782-26357804 GGCTCAAGGGGTACATGTGCAGG - Intergenic
1136072604 16:27797025-27797047 GATTAAATGAGTCCATGGACAGG - Intronic
1136696172 16:32084042-32084064 GGCTCAAGGGGCCCGTGGGCGGG - Intergenic
1136729280 16:32393000-32393022 GGCTCAAGGGGTACATGAGCAGG + Intergenic
1136796666 16:33027294-33027316 GGCTCAAGGGGCCCGTGGGCGGG - Intergenic
1137357668 16:47782247-47782269 GGTTCAAGGGGTACAAGTGCAGG + Intergenic
1138091453 16:54177953-54177975 GATTCAGAGGGTGCATGGGCAGG - Intergenic
1138729621 16:59180848-59180870 GGTTCAAGGGGTACATGTGTGGG + Intergenic
1139088306 16:63615770-63615792 GATTCAAGGGGTACATGTGCAGG + Intergenic
1139305033 16:65977940-65977962 GGTTCAAGGGTTACACGGGCAGG - Intergenic
1139571249 16:67814038-67814060 GGTTCTCTGGGTTCATGGGGAGG + Intronic
1140938728 16:79700931-79700953 GATTCAGAGGGTCCATGGGCAGG + Intergenic
1141088468 16:81113570-81113592 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1141399027 16:83730684-83730706 GATTCAGGGGGTCCATGGGCAGG + Intronic
1141805589 16:86339305-86339327 GGTTCAGAGGGTGCATGTGCAGG + Intergenic
1202997118 16_KI270728v1_random:124521-124543 GGCTCAAGGGGTACATGAGCAGG - Intergenic
1203023805 16_KI270728v1_random:436863-436885 GGCTCAAGGGGTACATGAGCAGG - Intergenic
1143830865 17:9649394-9649416 GATTCAGTGGGTACATGTGCAGG + Intronic
1145203083 17:20964460-20964482 GATTCAAGGGGTACATGTGCGGG + Intergenic
1145280844 17:21465943-21465965 GATTCAGGGGGTCCATGTGCAGG - Intergenic
1146817598 17:35955689-35955711 GGTTCAGGGAGTGCATGGGCAGG + Intergenic
1146821240 17:35984929-35984951 GGTTCAATGGGGACATGGGCAGG - Intronic
1149301791 17:55311690-55311712 GATTCAGTGGGTACATGTGCAGG + Intronic
1149557404 17:57584000-57584022 GGTTCAGTGGGTCCAGGGTGGGG + Intronic
1150557417 17:66266978-66267000 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1152063455 17:78096388-78096410 GGTTCAGGGAGTCCATGTGCAGG - Intronic
1152961741 18:84137-84159 GGATCAGAGGGTCCGTGGGCAGG + Intergenic
1152984554 18:309930-309952 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1153055814 18:945359-945381 GATTCAGTGGGTACATGTGCAGG + Intergenic
1153068746 18:1079697-1079719 GGTTCAAGGGGTATATGTGCAGG - Intergenic
1153140035 18:1960704-1960726 GGTTCAGGGGCTCCATGGGCGGG - Intergenic
1153342621 18:3991008-3991030 GGTTCAAGGGGTACATGAGCAGG + Intronic
1153817653 18:8805128-8805150 GGTTCAGGGGGTACATGTGCAGG + Intronic
1155775693 18:29757612-29757634 GGTTCAAGGGTTACATGTGCAGG - Intergenic
1155937675 18:31771059-31771081 GATTCAGTGGGTACATGTGCAGG - Intergenic
1156091979 18:33482468-33482490 GGTTCAAGGGGTACTTGTGCAGG + Intergenic
1158035436 18:53023549-53023571 GGTTCAGGGGGTCCATGTGCAGG - Intronic
1158560113 18:58506340-58506362 GATTCATGGGGTCCATGTGCAGG - Intronic
1158762665 18:60408931-60408953 GGTTCCATGGGTACATGGGTAGG - Intergenic
1159351136 18:67274179-67274201 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1159540320 18:69766366-69766388 GATTCAGTGGGTACATGTGCAGG - Intronic
1160639320 19:114626-114648 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1161866492 19:6836476-6836498 GGTCCAATGGCTCCAGGGGGTGG - Exonic
1162450720 19:10752757-10752779 GGTTAAATGGGTTAATAGGCAGG + Intronic
1162475853 19:10898919-10898941 GGTTGAGTGTGTCCATGGGGAGG + Intronic
1163223729 19:15939978-15940000 GCTGCAATGGGTACCTGGGCTGG - Intergenic
1164499062 19:28797714-28797736 GATTCAGTGGGTACATGTGCAGG + Intergenic
1164898479 19:31897898-31897920 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1165685165 19:37813484-37813506 GCTTCATTGGTTTCATGGGCTGG - Intronic
1166288546 19:41847414-41847436 GGTTCCATGGATCTAGGGGCAGG - Exonic
1167599220 19:50444334-50444356 GGATGAATGGGTCAATGGGATGG - Intronic
1167724584 19:51201462-51201484 GATTCTAGGGGTCCATAGGCAGG + Intergenic
1167812264 19:51844317-51844339 TGTTCACTGGGTCCATATGCTGG + Intergenic
1168049958 19:53822210-53822232 GATTCAAGGGGTACATGTGCAGG - Intronic
1202645374 1_KI270706v1_random:134209-134231 GGTTCAGCGGGTACATGTGCAGG - Intergenic
924962978 2:50461-50483 GGTTCAGTGAGTACATGTGCAGG - Intergenic
925061088 2:890814-890836 GGTCCAGTGTGTCCATGGCCAGG + Intergenic
925061096 2:890847-890869 GGTCCAGTGTGTCCATGGCCAGG + Intergenic
925221458 2:2144631-2144653 GGTTCACTGGAACCAGGGGCTGG - Intronic
926072040 2:9904139-9904161 GGTTCAAGGGGCACATGGGCAGG + Intronic
926531291 2:14049535-14049557 GGTTCAAGGGGTACATGAGCAGG + Intergenic
926566088 2:14475745-14475767 GGTTCACGGGGTACATGTGCAGG - Intergenic
927128103 2:20031988-20032010 GGTTCAGAGGGTACATGTGCAGG - Intergenic
927442172 2:23126904-23126926 GATTCAGGGGGTCCATGTGCAGG - Intergenic
928815225 2:35285842-35285864 GGTTCAAGGGGTTCATGTGCAGG - Intergenic
929136927 2:38633751-38633773 GATTCAAGGGGTGCATGTGCAGG + Intergenic
929794983 2:45052307-45052329 GGTTCAGCGGGTACATGTGCAGG + Intergenic
929929902 2:46245735-46245757 GGTTCAAGGGATACATGTGCAGG + Intergenic
930589005 2:53304844-53304866 GATTCAAGGGGTACATGTGCAGG + Intergenic
931496185 2:62809525-62809547 GATTCAAGGGGTACATGTGCAGG + Intronic
932072268 2:68633201-68633223 GATTCAGGGGGTACATGGGCAGG + Intergenic
932601647 2:73131103-73131125 TGTTCAGTGGGTACATGTGCAGG + Intronic
933118839 2:78509697-78509719 GATTCAGTGGGTACATGTGCAGG - Intergenic
933142948 2:78816379-78816401 GGTTCCATGTGTCCCTTGGCTGG - Intergenic
933337229 2:80974180-80974202 GATTCAAAGGGTACATGTGCAGG - Intergenic
933362086 2:81300551-81300573 GGTTCATGGGGTACATGTGCAGG + Intergenic
933864533 2:86504042-86504064 GGTTCAGGGGGTACATGTGCAGG - Exonic
934185579 2:89670911-89670933 GGCTCAAGGGGTACATGAGCAGG + Intergenic
934258095 2:91443835-91443857 TGCTCAAGGGGCCCATGGGCGGG + Intergenic
934507777 2:94907791-94907813 GGTTCAGCGGGTACATGTGCAGG - Intergenic
934636902 2:95997985-95998007 GGTTCAAGGGGTACATGCGAAGG + Intergenic
934649186 2:96080073-96080095 GGTTCAACGGGTACATGTGAAGG + Intergenic
935842895 2:107132825-107132847 GGGTCAAGGGGTCCTTGGGAGGG + Intergenic
937643818 2:124243783-124243805 GGTTCAAGGGGTACATGGGCAGG - Intronic
938719799 2:134056438-134056460 GGTGGAGTGGGTCCCTGGGCAGG - Intergenic
939329720 2:140741500-140741522 GGTTTAGTGGGTACATGTGCAGG + Intronic
940170409 2:150824053-150824075 GGTTCAAAGGGTACATATGCAGG - Intergenic
940541388 2:155024851-155024873 GGTCCAAGGGATCCATGTGCAGG + Intergenic
941121458 2:161535262-161535284 GATTCAAAGGGTACATGTGCAGG - Intronic
941146069 2:161847367-161847389 GGTTCAAGGGGTATATGTGCAGG + Intronic
941310765 2:163928008-163928030 GGTTCAGGGGGTACACGGGCAGG - Intergenic
941802797 2:169679244-169679266 GGTTCAAAGGCTACATGCGCAGG + Intronic
942632345 2:177964404-177964426 GGTTCAGGGGGTACATGTGCAGG + Intronic
943092569 2:183392098-183392120 GGTTCAAGGTGTACATGTGCAGG - Intergenic
943124292 2:183777272-183777294 GGTTTAGTGGGTACATGTGCAGG + Intergenic
943839747 2:192564092-192564114 GATTCAGTGGGTACATGTGCAGG + Intergenic
944546284 2:200802201-200802223 GGTTGAGGGGGTCCATGTGCAGG - Intergenic
944882954 2:204033399-204033421 GATTCAGGGGGTCCATGTGCAGG + Intergenic
944940271 2:204617580-204617602 GGTTCAAGGGGTACATGTGCAGG + Intronic
945487317 2:210412177-210412199 GGTTCAAGGGGTACATATGCAGG + Intergenic
945556416 2:211281752-211281774 GCTTCAAGGGGTCAATGAGCTGG - Intergenic
947043434 2:225949868-225949890 GGTTGAATGGATCCATGCTCAGG - Intergenic
1169177321 20:3528690-3528712 GGTTCAAGGGGTCCATGTGCAGG - Intronic
1169521631 20:6379915-6379937 GGTTCAATGGGTGTATGTGCAGG - Intergenic
1169989495 20:11485213-11485235 GGTTCAAGAGGTGCATGTGCAGG + Intergenic
1170090018 20:12580512-12580534 GAATCAAGGGGTACATGGGCAGG + Intergenic
1171308604 20:24127424-24127446 GGTTCAGCGGGTACATGTGCAGG - Intergenic
1171895335 20:30753131-30753153 GGTTCAGTGGGTACATGTGGAGG - Intergenic
1173281084 20:41628578-41628600 GATTCAGTGGGTACATGTGCAGG + Intergenic
1173772394 20:45672815-45672837 GGTTCAAGGAGTACATGTGCAGG - Intergenic
1174036744 20:47673202-47673224 GAGTCACTGGGTCAATGGGCTGG - Intronic
1174176504 20:48648768-48648790 GGTTCAATGGCACCTTGGGGAGG - Intronic
1176606514 21:8838534-8838556 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1177009860 21:15718849-15718871 GGTTCACAGGGTACATGTGCAGG - Intergenic
1180356587 22:11848234-11848256 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1180381675 22:12144097-12144119 GGTTCAGCGGGTACATGTGCAGG - Intergenic
1181557441 22:23679393-23679415 GATTCAAGGGGTACATGTGCAGG - Intergenic
1181828397 22:25538571-25538593 GATTCAAAGGGTACATGTGCAGG - Intergenic
1183602135 22:38845839-38845861 GGATAAATGGGTCCAGAGGCTGG + Intergenic
1183765493 22:39869594-39869616 GATTCAAGGGGTACATGTGCAGG - Intronic
1184156556 22:42671344-42671366 GGTTCAGGGGGTGCATGTGCAGG - Intergenic
1184481516 22:44750976-44750998 GATTCAAGGGGTACATGTGCAGG - Intronic
1185318878 22:50191117-50191139 GGTGCAATGGGGCCATGGTCGGG - Intronic
949104703 3:189969-189991 GATTCAGTGGGTACATGTGCAGG + Intergenic
949865305 3:8542327-8542349 GGATCACTGGGTCCTTGGGAAGG + Intronic
950341633 3:12251248-12251270 GATTCATTGGGTACATGTGCAGG - Intergenic
951267690 3:20588811-20588833 GGTTCAAGGGATACATGTGCAGG + Intergenic
951461914 3:22960099-22960121 GATTCAAGGGGTACATGTGCAGG - Intergenic
951766831 3:26208977-26208999 GGTTCAAGGGGTACATGTGCAGG + Intergenic
953695909 3:45159012-45159034 GGTTCAAGGGGTACATGTGCAGG + Intergenic
954657805 3:52207501-52207523 GGTTCAGTGGGTACATGTGCGGG + Intronic
955151104 3:56368130-56368152 GATTCAAGGGGTACATGTGCAGG - Intronic
955265593 3:57440649-57440671 GATTCAAGGGGTACATGTGCAGG - Intronic
956232459 3:67031910-67031932 GGTTCAGGGGGTACATGTGCCGG - Intergenic
956671789 3:71698222-71698244 CGTTCAGTGGCTACATGGGCAGG + Intronic
957535725 3:81501079-81501101 GGTTCAGGGGGTACATGTGCAGG - Intronic
957582516 3:82092850-82092872 GATTCAGTGGGTACATGTGCAGG + Intergenic
958872340 3:99575410-99575432 GGTTCAGTGGGTACATGTGTAGG - Intergenic
959204828 3:103293217-103293239 ATTTCAATGGGTCAATGAGCTGG + Intergenic
960005682 3:112778396-112778418 GGTTCAATTATTGCATGGGCTGG + Intronic
962693274 3:137922799-137922821 AGTTCAAGGGGTACATGTGCAGG - Intergenic
962954884 3:140255733-140255755 GGTTCAAGGGGTATATGTGCAGG - Intronic
962955263 3:140260091-140260113 GGTTCAAGGGGTACATGGGCAGG - Intronic
963393209 3:144696437-144696459 GGTTCAAGGGGTGCGTGTGCAGG + Intergenic
964038062 3:152222897-152222919 GGTTCAAGGGGTACATGTGCAGG + Intergenic
965063727 3:163816184-163816206 GATTCAAGGGGTGCATGTGCAGG - Intergenic
966053161 3:175647314-175647336 GATTCAGTGGGTACATGTGCAGG + Intronic
966362173 3:179141988-179142010 GGTTCAAGGGGTACATGTGCAGG - Intergenic
966459430 3:180159770-180159792 GATTCAAGGGGTACATGTGCAGG + Intergenic
966499359 3:180621595-180621617 GGTTCAAGGGCTACATGTGCAGG + Intronic
966654637 3:182341838-182341860 GGTTCAAGAGGTACATGTGCAGG - Intergenic
966837785 3:184062335-184062357 GGTTCAAGGGGTACATGTGCAGG + Intergenic
966901081 3:184485922-184485944 GATTCAGTGGGTACATGTGCAGG + Intronic
967398725 3:189036401-189036423 GGTTCATGGGGTACATGTGCAGG - Intronic
967566957 3:190984739-190984761 GGTTCAGGGGGTGCATGTGCAGG + Intergenic
967622146 3:191646733-191646755 GGTACAAGGGGTACATGTGCAGG - Intergenic
967640420 3:191856214-191856236 GGTTCAGTGGGTACATGTGCAGG + Intergenic
968928146 4:3560788-3560810 GGATGAGTGGGTGCATGGGCAGG - Intergenic
969182459 4:5452543-5452565 GATTCAACGGTTCCAGGGGCAGG + Intronic
969952004 4:10846665-10846687 GGTTCACGGGGTACATGTGCAGG - Intergenic
970379747 4:15494934-15494956 GGTTCAAGGGGTACATGTGCAGG + Intronic
970405405 4:15758161-15758183 GTTTCAGGGGGTACATGGGCAGG + Intergenic
971566895 4:28156122-28156144 GGTTCAAGGGGTACATGTGTAGG + Intergenic
971704063 4:30016378-30016400 GTTTCAGTGGGTACATGTGCAGG + Intergenic
971706626 4:30052038-30052060 GGTTCAAGGTGTACATGTGCAGG + Intergenic
971923112 4:32969477-32969499 GGTTCAGGGGGTACATGTGCAGG - Intergenic
972282830 4:37619475-37619497 GGTTAAAAGGGTGCAGGGGCTGG - Intronic
972833475 4:42840743-42840765 TTTTCAATAGGTACATGGGCTGG - Intergenic
973371596 4:49252624-49252646 GGTTCAGCGGGTACATGTGCAGG - Intergenic
973389410 4:49542687-49542709 GGTTCAGCGGGTACATGTGCAGG + Intergenic
973657476 4:53064142-53064164 GATTCAAAGGGTACATGTGCAGG + Intronic
973958646 4:56088169-56088191 GGTTCAAGGGGTACATGTGCAGG + Intergenic
973973838 4:56242683-56242705 GGTTCAAGTGCTCCATGGACAGG - Intronic
974445663 4:61977812-61977834 GATTCATGGGGTACATGGGCAGG + Intronic
974621931 4:64367359-64367381 GGTTCAGGGGGTGCATGTGCAGG - Intronic
975975580 4:80092103-80092125 GGTTCAGTGGGTACGTGTGCAGG - Intronic
976561358 4:86505273-86505295 GATTCAGGGGGTACATGGGCAGG - Intronic
977754117 4:100646149-100646171 GGTTCAGGGGGTACATGTGCAGG + Intronic
977845755 4:101764658-101764680 GATTCAAAGGGTACATGTGCAGG + Intronic
977948714 4:102944353-102944375 GGCTCAAGGGGTACATGAGCAGG - Intronic
977956749 4:103036485-103036507 GGTTCAAGGGGTACATGTGCAGG - Intronic
978402788 4:108348880-108348902 GGTTCAAGGGGTACATGCACAGG + Intergenic
978677027 4:111330793-111330815 GGCTCAGTGGGTACATGTGCAGG - Intergenic
978691880 4:111523610-111523632 GATTCAGGGGGTACATGGGCAGG + Intergenic
978926964 4:114258199-114258221 GCTTCAAGGGGTACATGTGCAGG - Intergenic
979401911 4:120259531-120259553 GGTACAAGGGGTACATGTGCAGG - Intergenic
979662624 4:123275512-123275534 GGTTCAAGGAGTACATGTGCAGG + Intronic
979830052 4:125288306-125288328 GGTTCAGCGGGTACATGTGCAGG + Intergenic
980095664 4:128487741-128487763 GGTTCAGGGGGTACATGTGCAGG - Intergenic
980144637 4:128966878-128966900 GATTCAGGGGGTACATGGGCAGG + Intronic
980878952 4:138689919-138689941 GATTCTGTGGGTCCATGTGCAGG - Intergenic
981394226 4:144228108-144228130 CGTTCAAGGGGTACATGTGCAGG - Intergenic
982431872 4:155332210-155332232 GGTACAGTGGGTACATGTGCAGG + Intergenic
982555383 4:156855859-156855881 GTTTCACTGGCTCCATGAGCTGG + Intronic
982806534 4:159772491-159772513 GGATCAGTGGGTACATGTGCAGG + Intergenic
982990652 4:162269532-162269554 GATTCAGTGGGTACATGTGCAGG - Intergenic
983526315 4:168763716-168763738 GGTACAATGGCTCCATGCACTGG - Intronic
983535824 4:168855870-168855892 GATTCACTGGTTACATGGGCAGG + Intronic
983886370 4:172984739-172984761 GATTCAGTGGGTGCATGTGCAGG - Intronic
986015519 5:3754085-3754107 GGTTCCATGCTTCCATGGGAAGG - Intergenic
986528596 5:8709188-8709210 GGTTCAAGGGGCTCATGTGCAGG + Intergenic
986532391 5:8752010-8752032 AGTTCAAGGGGTACATGTGCAGG - Intergenic
989281071 5:39643994-39644016 GGTTCAGTGGGTATATGTGCAGG + Intergenic
989359905 5:40590016-40590038 GATTCAAGGGGTACATGTGCAGG + Intergenic
991274755 5:64831689-64831711 GGTTCAAGGGGTACATGAGCAGG - Intronic
991404515 5:66289018-66289040 GATTCAGGGGGTCCATGTGCAGG - Intergenic
993429927 5:87819569-87819591 GGTTCAGGGGGTACATGTGCAGG - Intergenic
993702084 5:91130647-91130669 GATTCAGTGGGTACATGTGCAGG + Intronic
993934041 5:93978748-93978770 GATTCAGTGGGTACATGTGCAGG - Intronic
994765112 5:103905645-103905667 GGTTCAAGGGGTACATGTGCAGG - Intergenic
995000049 5:107116388-107116410 GCTTCAGTGGGTACATGTGCAGG - Intergenic
995328066 5:110914331-110914353 GGTTCTAAGGGTGCATGTGCAGG + Intergenic
996190848 5:120539636-120539658 GGTTCAAGGGGCACATGTGCAGG - Intronic
997792576 5:136774101-136774123 ATTTCAATGGGTCAATGGTCAGG + Intergenic
998647805 5:144082802-144082824 GGTTCAGTAGGTACATGTGCAGG - Intergenic
999541501 5:152579134-152579156 GGTTCAATGGGTACATATGCAGG + Intergenic
999597933 5:153226207-153226229 GGTTCAAGGGGTGCATGTGCAGG + Intergenic
1000246545 5:159453103-159453125 GGTGCAATTGGGCCATGGGCAGG - Intergenic
1002501124 5:179648390-179648412 GATTCAGTGGGTGCATGCGCAGG - Intergenic
1002746671 6:63032-63054 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1003038747 6:2668136-2668158 GGTTCAAGGGGTACATGTGCAGG + Intronic
1003739082 6:8914149-8914171 GGTTCAAAGAGTACATGTGCAGG - Intergenic
1004446421 6:15703620-15703642 GTTTCAAGGGGTACATGTGCAGG - Intergenic
1004823513 6:19395804-19395826 GATTCAAGAGGTACATGGGCAGG - Intergenic
1005687187 6:28265921-28265943 GGTTCAGTGGGTACATGTGCAGG + Intergenic
1005777490 6:29151810-29151832 GGTTCAAGTGGTACATGTGCAGG + Intergenic
1005909664 6:30297404-30297426 GGTTCAAGGGGTACATGTGTAGG + Intergenic
1006749931 6:36370653-36370675 GGTTCAGGGGGTGCATGTGCAGG - Intronic
1008026363 6:46640635-46640657 GATTCAAAGGGTACATGTGCAGG + Intronic
1008081550 6:47199964-47199986 GATTCAGGGGGTCCATGTGCAGG + Intergenic
1008265017 6:49414404-49414426 GGTTCAAGGGGTTCATGTGCAGG - Intergenic
1008285438 6:49643727-49643749 GGTTCAAGGGGTACATGTTCAGG + Intergenic
1008552607 6:52647233-52647255 GGTGCTGTGGGTCCATGGGAAGG + Intergenic
1008906785 6:56686411-56686433 GATTCAGTGGGTACATGTGCAGG - Intronic
1009033260 6:58085931-58085953 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1009208870 6:60837706-60837728 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1009448252 6:63769192-63769214 GGTTCAGGGTGTCCATGTGCAGG - Intronic
1010010822 6:71046242-71046264 GATTCAGTGGGTACATGTGCAGG + Intergenic
1010305466 6:74316499-74316521 GATTCAAGGGGTACATGTGCAGG + Intergenic
1010477293 6:76303757-76303779 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1011121141 6:83954407-83954429 GGTTCAGGGGGTACATGTGCAGG + Intronic
1011341234 6:86316883-86316905 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1011797783 6:90976306-90976328 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1012462686 6:99481534-99481556 GATTCAAGGGGTACATGTGCAGG + Intronic
1013376911 6:109526258-109526280 GGTTCAGAGGGTACATGTGCAGG - Intronic
1013433149 6:110073965-110073987 GATTCAGTGGGTACATGTGCAGG - Intergenic
1013933755 6:115568665-115568687 GGTTCAAGGGGTGCATGTGTAGG - Intergenic
1014290559 6:119553127-119553149 GATTCAAGGGGTACATGTGCAGG + Intergenic
1014567569 6:122969142-122969164 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1016038323 6:139406051-139406073 GATTCAAGGGGTCCGTGTGCAGG + Intergenic
1016303557 6:142658246-142658268 GGTTCATGGGGTACATGTGCTGG + Intergenic
1016372207 6:143386811-143386833 GGTTCAAGGGGTCCATGTTCAGG + Intergenic
1017483175 6:154878424-154878446 GGTTCATGGGGTACATGCGCAGG + Intronic
1017929843 6:158942230-158942252 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1019948159 7:4346743-4346765 GGTTCAATGGATCCATTTTCTGG + Intergenic
1020674122 7:11159933-11159955 GATTCAAGAGGTACATGGGCAGG + Intronic
1020687138 7:11309887-11309909 GGTTCTAGGGGTACATGTGCAGG + Intergenic
1020852012 7:13365969-13365991 GGTTCAGAGGGTACATGTGCAGG + Intergenic
1020986993 7:15148348-15148370 GGTTCAATGAGTTCATGTTCAGG + Intergenic
1021313761 7:19120165-19120187 GGCTGAAAGAGTCCATGGGCAGG - Intergenic
1021346374 7:19533760-19533782 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1021750251 7:23791590-23791612 GGTTCAAGGGGTACATGTGCAGG - Intronic
1023472135 7:40535178-40535200 GATTCCATGGGTACATGTGCTGG + Intronic
1023949183 7:44828329-44828351 GGTTCAGTGAGAACATGGGCAGG - Intronic
1025140740 7:56461318-56461340 GGTTCAAGGGTTACATGTGCAGG - Intergenic
1025240724 7:57269864-57269886 GGTTCAAGGGTTACATGTGCAGG - Intergenic
1025706523 7:63870300-63870322 GGTTCAAGGGTTACATGTGCAGG - Intergenic
1026083879 7:67246440-67246462 GATTCAGTGGGTACATGTGCAGG - Intergenic
1026536156 7:71240295-71240317 GATTCAAGGGGTACATGTGCAGG + Intronic
1026693159 7:72567611-72567633 GATTCAGTGGGTACATGTGCAGG + Intronic
1027147208 7:75704026-75704048 GGTTCACTGGTTCCCAGGGCAGG - Intronic
1027641261 7:80736292-80736314 TGTTCAAGGGGTACATGTGCAGG - Intergenic
1027812516 7:82922708-82922730 GGTTCAGAGGGTACATGTGCAGG - Intronic
1027887193 7:83923928-83923950 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1028700009 7:93766399-93766421 GATTCAAGGGGTACATGTGCAGG - Intronic
1028840639 7:95426216-95426238 GATTCAAGGGGTACATGTGCAGG - Intronic
1029015718 7:97313666-97313688 AGTGCAACTGGTCCATGGGCTGG + Intergenic
1029020166 7:97356957-97356979 GGTATAGTGGGTCCATGGGAAGG - Intergenic
1029599813 7:101557147-101557169 GGATGAATGGGTCAATGGACAGG + Intronic
1030068234 7:105676878-105676900 GATTCAAGGGGTACATGTGCAGG - Intronic
1030805199 7:113909106-113909128 GATTCAAGGGGTCCATGTGCAGG - Intronic
1031342306 7:120618133-120618155 GGTTCAGGGGGTACATGCGCAGG - Intronic
1031911737 7:127523996-127524018 GGTTCAGGGTGTACATGGGCAGG - Intergenic
1032231241 7:130076287-130076309 GGTACCAGGGGTCCATGGCCTGG + Intronic
1032848188 7:135769746-135769768 GATTCAGGGGGTACATGGGCAGG - Intergenic
1033613977 7:142993445-142993467 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1034359208 7:150479288-150479310 GGTTCAAGGGGTACATGCACAGG - Exonic
1035164908 7:156981275-156981297 TGTTCTGTGGGTTCATGGGCGGG + Intergenic
1040907980 8:52488297-52488319 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1041079219 8:54200619-54200641 GGCTCAGTGGGTACATGTGCAGG + Intergenic
1043183927 8:77120948-77120970 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1043290598 8:78595456-78595478 GGTTCAAGGGGTACATATGCAGG + Intronic
1044086647 8:87950576-87950598 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1044960866 8:97529423-97529445 GGTTCAAGGGGTATATGTGCAGG - Intergenic
1045209521 8:100082241-100082263 GGTTTAAGGGGTACATGTGCAGG + Intronic
1045725499 8:105168531-105168553 GGTTAAATGAGACAATGGGCTGG + Intronic
1045786278 8:105924650-105924672 GATTCAAGGGGTACATGTGCAGG - Intergenic
1045922876 8:107552955-107552977 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1046060671 8:109135664-109135686 GGTTCAATTGGTGCATATGCTGG - Intergenic
1046323238 8:112605758-112605780 GGTTCAGGGGGTACATGTGCAGG - Intronic
1046444454 8:114298644-114298666 GGTTCAGTGGGTACATGTGCAGG - Intergenic
1046455161 8:114449727-114449749 GATTCAAGGGGTACATGTGCAGG - Intergenic
1046908325 8:119598787-119598809 GGTTAAATGGTTCCATGGAAGGG + Intronic
1047898615 8:129395287-129395309 GATTCAAGGGGTACATGTGCAGG - Intergenic
1047898643 8:129396035-129396057 AGTTCAAGGGGTACATGTGCAGG - Intergenic
1049078496 8:140420627-140420649 TGTTCAAGGGGTACATGTGCAGG + Intronic
1049120920 8:140736497-140736519 GATTCAGAGGGTCCATGTGCAGG - Intronic
1049760891 8:144331657-144331679 GCTGTAATGGTTCCATGGGCGGG - Exonic
1050062855 9:1728653-1728675 GGTGCAATGGGCGCATGGGGTGG + Intergenic
1050757418 9:9023560-9023582 GATACAAGGGGTCCATGTGCAGG + Intronic
1051327340 9:15987393-15987415 GGTTCAAGGGGTACATGTGCAGG - Intronic
1053803015 9:41775898-41775920 GGATGAGTGGGTGCATGGGCAGG - Intergenic
1054191304 9:61987208-61987230 GGATGAGTGGGTGCATGGGCAGG - Intergenic
1054353317 9:64039638-64039660 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1054461996 9:65470371-65470393 GGATGAGTGGGTGCATGGGCAGG + Intergenic
1055821344 9:80268067-80268089 GATTCAATGGGTACATGTGCAGG + Intergenic
1055869213 9:80854363-80854385 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1055900586 9:81229651-81229673 GGTTCAAGGGGTACATGCGTAGG + Intergenic
1055990968 9:82105212-82105234 GGTTCAAAGAGTACATGTGCAGG + Intergenic
1056298922 9:85221824-85221846 GGTTCAAGGGGCACATGTGCAGG - Intergenic
1056959519 9:91110484-91110506 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1058318748 9:103602586-103602608 GGTTCAGGGGGTACATGGGCTGG - Intergenic
1058946290 9:109859761-109859783 GGTTAAATGGGTACATGGCTAGG + Intronic
1059140942 9:111852669-111852691 GATTCAAGGGGTACATGTGCAGG - Intergenic
1060306251 9:122414968-122414990 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1060906232 9:127308506-127308528 GGTTGAAGGGGTACATGTGCAGG - Intronic
1061626212 9:131842242-131842264 GTTTCAAGGGGTTCATGGGATGG - Intergenic
1062244812 9:135560659-135560681 GGCACAATGTGTTCATGGGCTGG - Intergenic
1062736409 9:138139967-138139989 GGATCAGAGGGTCCGTGGGCAGG - Intergenic
1203696036 Un_GL000214v1:97692-97714 GGTTCAGCGGGTACATGTGCAGG - Intergenic
1203741650 Un_GL000218v1:8747-8769 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1203701835 Un_KI270742v1:3336-3358 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1203553826 Un_KI270743v1:189393-189415 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1203640237 Un_KI270751v1:6371-6393 GGTTCAGCGGGTACATGTGCAGG + Intergenic
1185624388 X:1472410-1472432 GGATGAATGGGTACATGGGTGGG + Intronic
1185872865 X:3679081-3679103 GATTCAGGGGGTCCATGTGCAGG + Intronic
1185881960 X:3749272-3749294 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1186092542 X:6065238-6065260 GGTTCAGAGGGTACATGTGCAGG - Intronic
1187836008 X:23433185-23433207 GATTCAAGGGGTACATGTGCAGG - Intergenic
1188025916 X:25209344-25209366 GATTCAAGGGGTACATGTGCAGG - Intergenic
1188341637 X:29009322-29009344 GGTTCATGGGGTACATGTGCAGG - Intronic
1188403660 X:29779571-29779593 GGTTCAGGGCGTACATGGGCAGG - Intronic
1188621107 X:32225337-32225359 GGTGTAATTGGCCCATGGGCAGG + Intronic
1188754353 X:33942679-33942701 GATTCAGTGGGTACATGTGCAGG - Intergenic
1188764812 X:34078808-34078830 TGTTCAGTGGGTACATGTGCAGG + Intergenic
1189362610 X:40364253-40364275 GATTCAAGGGGTACATGTGCAGG + Intergenic
1189664967 X:43344377-43344399 GATTCAGTGGGTACATGTGCAGG + Intergenic
1190910973 X:54772473-54772495 GGTTCAGTGGATACATGAGCAGG - Intronic
1191752294 X:64556022-64556044 GGTTCAGGGGGTACATGTGCAGG - Intergenic
1191819397 X:65286531-65286553 GGTTCAAAGGGTACATGTGCAGG - Intergenic
1192725168 X:73742781-73742803 GGTTCAAGGAGTACATGTGCAGG + Intergenic
1192866444 X:75137997-75138019 GGTTCAAGGGATACATGAGCAGG - Intronic
1192952564 X:76032791-76032813 GATTCAAGGGGTACATGTGCAGG + Intergenic
1193051464 X:77104012-77104034 GGTTCAGGGGGTTCATGTGCAGG + Intergenic
1193403887 X:81079256-81079278 GGTACAAGGGGTACATGTGCAGG - Intergenic
1193527105 X:82605653-82605675 GATTCAAGGGGTACATGTGCAGG - Intergenic
1193903464 X:87213433-87213455 GATTCAGTGGGTACATGTGCAGG + Intergenic
1193916775 X:87374585-87374607 GGTTCAAAGGGTACATGTGCAGG - Intergenic
1194215358 X:91124227-91124249 GGTCCAAGGGGTACAGGGGCAGG - Intergenic
1194583958 X:95710509-95710531 GATTCAAAGGGTACATGTGCAGG - Intergenic
1194894135 X:99417863-99417885 GGTTCAGGGGGTCCATTTGCAGG - Intergenic
1194904276 X:99554272-99554294 GGTTCAAGGGGTACACGTGCAGG + Intergenic
1195124143 X:101788285-101788307 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1195448568 X:104982117-104982139 GGTTCATGGGGTACATGTGCAGG - Intronic
1196702803 X:118689989-118690011 GGTTCAGGGGGTACATGTGCAGG + Intergenic
1196760385 X:119195700-119195722 GATTCAAGGGGTACATGCGCAGG - Intergenic
1198401938 X:136277235-136277257 GGCTGAATGGGCCCATGGGTGGG - Intergenic
1199366579 X:146992740-146992762 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1199718035 X:150520515-150520537 GGTTCAGCGGGTACATGGGCAGG - Intergenic
1199932116 X:152533863-152533885 GGTTCAGTGGGTACATGTGCAGG + Intergenic
1200278025 X:154752231-154752253 GGTTCAGTAAGTCAATGGGCAGG + Intergenic
1200326371 X:155244732-155244754 GGTTCAGAGGGTACATGTGCAGG - Intergenic
1200383258 X:155861995-155862017 GGTTTAGTGGGTACATGTGCAGG + Intergenic
1201155178 Y:11126202-11126224 GGTTCAGCGGGTACATGTGCAGG + Intergenic