ID: 1064820097

View in Genome Browser
Species Human (GRCh38)
Location 10:19319663-19319685
Sequence CAAGCAGGCACCATCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064820097_1064820099 -7 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820099 10:19319679-19319701 CTGCTTGCTGTTTCCTCACGCGG No data
1064820097_1064820100 0 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820100 10:19319686-19319708 CTGTTTCCTCACGCGGTAGAAGG No data
1064820097_1064820101 1 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820101 10:19319687-19319709 TGTTTCCTCACGCGGTAGAAGGG No data
1064820097_1064820105 20 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820105 10:19319706-19319728 AGGGACTTGCTAGCTCTCTGGGG No data
1064820097_1064820103 18 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820103 10:19319704-19319726 GAAGGGACTTGCTAGCTCTCTGG No data
1064820097_1064820104 19 Left 1064820097 10:19319663-19319685 CCTTCATGGATGGTGCCTGCTTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1064820104 10:19319705-19319727 AAGGGACTTGCTAGCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064820097 Original CRISPR CAAGCAGGCACCATCCATGA AGG (reversed) Intronic
900503036 1:3015999-3016021 CAAGTAGGTGCCACCCATGAGGG - Intergenic
900955782 1:5885520-5885542 GAAGCAGCCACCAAGCATGAGGG + Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
905277770 1:36830021-36830043 CAAGCAGGCAGCTTCCAGCAGGG - Intronic
907672982 1:56493003-56493025 CCAGCAGGGACCAGGCATGATGG - Intergenic
909173360 1:72322500-72322522 AGTGCAGGCACCAGCCATGAGGG - Intergenic
911797924 1:102097628-102097650 TTAGCTGGCACCACCCATGAGGG + Intergenic
913162926 1:116161691-116161713 TAACCAGGCACCATCTGTGAGGG + Intergenic
919185454 1:194141779-194141801 CAATCAGGCACCATACTTGCTGG + Intergenic
920282189 1:204852625-204852647 CAGGAAGGCTCCAGCCATGAAGG - Intronic
920397773 1:205659396-205659418 CAGGAAGGCACTATCCAGGATGG + Exonic
922579230 1:226684875-226684897 CAGGCAGGGGCCCTCCATGATGG - Intronic
1064820097 10:19319663-19319685 CAAGCAGGCACCATCCATGAAGG - Intronic
1065815713 10:29480728-29480750 ACAGCAGGCACCATCCTGGACGG - Exonic
1069732636 10:70628400-70628422 CAAGAAGGTGCCATCTATGAAGG - Intergenic
1070932517 10:80271413-80271435 CATGCAGACACCATGCAGGAAGG + Intergenic
1071628784 10:87200610-87200632 CAGTCAGTCTCCATCCATGATGG + Intergenic
1073460355 10:103662224-103662246 TAAGCAGGCACCAGGCAGGAAGG + Intronic
1075676933 10:124302283-124302305 CAAGGAAGCACCATCCATGGAGG - Intergenic
1077522705 11:3045738-3045760 CAAGCATGCACCTTCCTTGCTGG - Intronic
1078582358 11:12548290-12548312 CAGGCAGGCCCAATCCATTAGGG + Intergenic
1078651316 11:13196581-13196603 CATCCAGATACCATCCATGATGG - Intergenic
1078858892 11:15229108-15229130 CAAGCAGGGACAATCTAGGATGG + Intronic
1078933936 11:15936046-15936068 CCAGCCTGGACCATCCATGAAGG + Intergenic
1085795667 11:79537377-79537399 CAAGTGGCCAGCATCCATGAAGG - Intergenic
1088515761 11:110631713-110631735 CAAGGAGCCACCATCCAGAAGGG - Intronic
1089007771 11:115106676-115106698 CAAGCTGGCATCATTCATCAAGG + Intergenic
1089202564 11:116733206-116733228 CAAGCAGGCACCAGCCCAGGAGG - Intergenic
1090893694 11:130950404-130950426 CAAAGAGGAACCATCCATGCTGG + Intergenic
1091312911 11:134587123-134587145 CAAGGAAGCACCAGCCCTGATGG - Intergenic
1098007184 12:66010011-66010033 CAAGCAGGTACTCTCCTTGAAGG - Intergenic
1099054133 12:77816571-77816593 CAACCAAGCACCATGCAAGAAGG - Intergenic
1099746265 12:86708409-86708431 CCAGCAGGCATTCTCCATGAGGG - Intronic
1102426054 12:112845231-112845253 CAAGCAGGCAGCATGCTAGAGGG - Intronic
1102531293 12:113548280-113548302 CAGGCAGGTAACATACATGAAGG + Intergenic
1104270271 12:127277232-127277254 CAAGCATGCACCATCCCCGCTGG - Intergenic
1104619426 12:130299793-130299815 CAAGGAGGGGCCATCCAGGAAGG - Intergenic
1105637071 13:22225769-22225791 CCAGCAGGCTCCAGCCTTGAGGG - Intergenic
1105969110 13:25412132-25412154 CAGGCAGGCATCCTCCAGGAGGG + Intronic
1115551726 14:34511092-34511114 CAAGCATACACCAAGCATGATGG - Intergenic
1115789168 14:36859456-36859478 CATCCAGGCACCATCCAGGAGGG + Intronic
1119688255 14:76650502-76650524 AAAGCAGTCACCATCCTTGCTGG + Intergenic
1120689506 14:87577013-87577035 AAAGCAGGCTCCATCCCAGAAGG + Intergenic
1122373574 14:101243135-101243157 CCAGCAGGCACCATTCCTGGGGG + Intergenic
1122952117 14:105050805-105050827 CATGCAGCCACCTTCCATGTGGG + Exonic
1126262126 15:46705363-46705385 AAAGCAGGTACCTTCCAAGAAGG - Intergenic
1127609029 15:60619081-60619103 CAAGAAGGGACAATCCATGTAGG - Intronic
1130393537 15:83480942-83480964 CAAACAGGCACCAGGCAAGAAGG - Intronic
1133518554 16:6533499-6533521 CAATCAAGCACCATCCCTGGAGG - Intronic
1136908850 16:34129536-34129558 CAAGGAGGCACCCTCCAGTAGGG - Intergenic
1137295930 16:47093375-47093397 CAAACAGGCAGCATCAATTACGG - Intronic
1137672241 16:50285716-50285738 CCAGCAGGAACCTTGCATGAAGG - Intronic
1139655110 16:68382734-68382756 CAAGGAGGCATCCTCCAGGAGGG + Intronic
1141548624 16:84789176-84789198 CACGCAGGCAGCAGCAATGACGG - Intergenic
1142203136 16:88770565-88770587 CAGGCAGGCACCGCCCATGGCGG - Intronic
1142401808 16:89862790-89862812 CAGGTGGGCACCATCTATGAAGG - Intronic
1146507265 17:33416315-33416337 CAAGCTTGCACCATTCATCATGG + Intronic
1146737688 17:35253109-35253131 TGAGAAGGCACCATCTATGAGGG - Intronic
1147937667 17:44022558-44022580 TAAGCAAGCACCATCCACGCAGG + Intronic
1151874918 17:76862346-76862368 CAAGCAGGCACCAACCAGACAGG - Intergenic
1152473226 17:80501802-80501824 CAGGCAGGTACCATCCACTACGG + Intergenic
1152901628 17:82944442-82944464 CAAGCAAGCACCATCAAGGCAGG + Intronic
1203162940 17_GL000205v2_random:68399-68421 TAAGCAAGCACCATCCATGCCGG - Intergenic
1153062162 18:1005556-1005578 CAGTCTGGCACCATCCATTAAGG - Intergenic
1156475555 18:37403387-37403409 CAAGGAGTCACCCTCCATGGAGG + Intronic
1158309846 18:56146055-56146077 CAATCAGCCACCATCCTTTATGG - Intergenic
1158978930 18:62739677-62739699 CAGGCATGGAGCATCCATGAAGG + Intronic
1160186490 18:76680325-76680347 GAAGCAGGCATGATGCATGAGGG + Intergenic
1160556650 18:79729819-79729841 CACACAGGCGCCACCCATGAGGG - Intronic
1162461580 19:10817012-10817034 AAAGCAGGCTCCATTCAGGAGGG + Intronic
1162570012 19:11466157-11466179 GAAGGAGGCACCAACCTTGATGG + Exonic
927272398 2:21226087-21226109 CATGCAGGAAGCAGCCATGATGG - Intergenic
927362550 2:22252863-22252885 CAAGAAGGCACTCTCCAGGAAGG - Intergenic
929612160 2:43279011-43279033 AAAGCAGGCACCCTCCCAGATGG + Intronic
930394016 2:50796939-50796961 CAACAAGGCACCATCTTTGAAGG - Intronic
931937964 2:67219115-67219137 CAAGCAGCCACCATCCCTTTTGG - Intergenic
932819472 2:74887271-74887293 CAGGCAGGCAACATTAATGAAGG + Intronic
935699939 2:105802661-105802683 GAGGAAGGCACCATGCATGAGGG + Intronic
936081261 2:109434173-109434195 CCAGCTGGCACCCTCCAGGAAGG + Intronic
936480505 2:112880640-112880662 CAAGCAGGAACCATGGATGTTGG + Intergenic
936687603 2:114846679-114846701 AAATCAGGCAGCATTCATGAAGG - Intronic
936836621 2:116718026-116718048 TAAGCAAGCACCATCCATGCCGG - Intergenic
938059042 2:128238050-128238072 CATGCCGGCAGCATCCATCAGGG + Intronic
941345398 2:164362249-164362271 GAAGCTGGCAAAATCCATGATGG - Intergenic
941657491 2:168159703-168159725 CAAGCAGCCACCATACATCTGGG + Intronic
942490430 2:176484417-176484439 AAAGCAGGCACCCTCTACGAAGG - Intergenic
942687061 2:178544048-178544070 CAAGGAGGCCCCAGCCCTGATGG + Exonic
945336607 2:208599821-208599843 CTAGCAGGCATTCTCCATGAGGG + Intronic
948263425 2:236621065-236621087 CAAGCAGGAAAAATCCAAGAGGG + Intergenic
948726110 2:239935031-239935053 AGAGCAGGCAGCATCCATGCAGG - Intronic
1169073576 20:2748768-2748790 CCAGCAGGCACCAACCAGGCTGG - Intronic
1169743500 20:8919882-8919904 CAAGCAGGCTCCCTCCAGCATGG + Intronic
1169979577 20:11368427-11368449 GAACTAAGCACCATCCATGATGG - Intergenic
1170079754 20:12461071-12461093 CAAGCAGTCACTCTCCATGCAGG + Intergenic
1172915324 20:38439232-38439254 CCAGGAGGTCCCATCCATGAGGG + Intergenic
1175604339 20:60299805-60299827 CAAGCAGGCAGGATCCTGGAGGG + Intergenic
1175933376 20:62503825-62503847 AAAGCAGGCACCGGCCATGCGGG + Intergenic
1179021924 21:37648319-37648341 CCAGCAGGTGCCATTCATGAAGG - Intronic
1179880264 21:44290684-44290706 ACAGCAGGCACCATCCAGGCAGG + Intronic
1180012917 21:45063165-45063187 CAAGAAGGCACCATCAATTGTGG + Intergenic
1181461910 22:23090640-23090662 CAAGCAGGCATCAGGGATGAGGG - Intronic
1183232283 22:36590502-36590524 CCTGCAGGCTCCATCCATCAGGG + Intronic
1184593035 22:45498501-45498523 CAGGCATCCACCATCCATGATGG - Intergenic
1184958117 22:47906151-47906173 AAACCATGCAGCATCCATGAGGG - Intergenic
1185305458 22:50112923-50112945 CAAACAGGCACCCGCCAGGAGGG + Intronic
951370773 3:21844413-21844435 CAAGAAAGCACCATCTATAATGG - Intronic
951402750 3:22254348-22254370 CAAGCAGGGTACATGCATGATGG + Intronic
951666854 3:25135801-25135823 CAATCAGGCACCATGCACCAAGG + Intergenic
953437876 3:42894136-42894158 CAACAAGGCACCATCTATGAAGG - Intronic
954124626 3:48521188-48521210 CAAGCAGGCCCCATCATGGATGG + Intronic
955798863 3:62665924-62665946 GCAGCAGCCACCATTCATGAGGG - Intronic
958859714 3:99431779-99431801 CATGAAGGCAGCATCTATGAGGG + Intergenic
962943550 3:140147326-140147348 AATGCAGGCCCCATCCTTGAAGG + Intronic
963977937 3:151503922-151503944 CAAGCAGGCACCACCCAGACTGG - Intergenic
964949227 3:162267275-162267297 CAAGCATGACCCTTCCATGAGGG + Intergenic
965746807 3:171934883-171934905 CATGCAGGAAGCAACCATGAAGG + Intronic
966022269 3:175229588-175229610 CTAAAAAGCACCATCCATGAGGG - Intronic
966297795 3:178444189-178444211 CTAGAAGGCACCATCTATGAGGG + Intronic
966693821 3:182768889-182768911 CAAGAAGGCACAATCTATGAAGG - Intergenic
966776364 3:183546094-183546116 CATGAAGGCATCATCCATCATGG - Intronic
969592034 4:8127565-8127587 CAAGCAGCCACGCTCCATGGGGG - Intronic
971002550 4:22339108-22339130 TAAGCAAGCACCATCTATGCCGG + Intergenic
972552192 4:40144182-40144204 CGGGCAGGCACCAACCATGTGGG - Intronic
978830439 4:113077880-113077902 AAAGCAGACACCACCCAGGATGG + Intronic
979796326 4:124850881-124850903 CAAGAAAGCAATATCCATGAAGG - Intergenic
979990715 4:127371947-127371969 GAAGCAGGCAGAATCCATAATGG + Intergenic
980478843 4:133358167-133358189 CAAGGAGGCAGAATCAATGAGGG - Intergenic
982006089 4:151064129-151064151 GAAGCAGGCAGCATCTAAGATGG - Intergenic
982042685 4:151410568-151410590 CAAGCAGGCATAATACATTAAGG - Intronic
982329145 4:154161935-154161957 CAAAAAGGCACCATTCATGGGGG + Intergenic
985213554 4:187622648-187622670 CAAGAAGGTGCCATCTATGAAGG + Intergenic
985916405 5:2921989-2922011 CCAGCAGGAAACCTCCATGATGG - Intergenic
988435903 5:31175124-31175146 CAAAATGGCAACATCCATGATGG + Intergenic
988828874 5:34968550-34968572 CATGCATGCACTATCCAGGATGG - Intergenic
990907877 5:60823152-60823174 CAAGAAGGAACAACCCATGAAGG + Intronic
991214703 5:64148888-64148910 CAGGCAGGCAGCCTCCGTGATGG - Intergenic
991412073 5:66355628-66355650 AAGGCAGGGACCATCCATGCAGG + Intergenic
1001229322 5:169972221-169972243 TAAGCAGGAACAATCTATGAGGG - Intronic
1001798284 5:174520310-174520332 CAGGCAGGCCCCACCCAAGAAGG + Intergenic
1003618250 6:7674370-7674392 GAAGCTGGCACCTTCCATCACGG - Intergenic
1010268651 6:73895961-73895983 CAAGCAGGAACTATCAATGAGGG - Intergenic
1014235075 6:118944962-118944984 CAAGGAAGCCCCATCCAGGAAGG + Intergenic
1016420719 6:143879873-143879895 CCAGCAGGCACAATCAATCATGG + Intronic
1017855503 6:158347713-158347735 CAAGAAGGCACCACCCAGGCAGG - Intronic
1018685214 6:166298783-166298805 GAGGCAGGCACCATCCAGAAGGG + Intergenic
1019293525 7:261888-261910 CATGCAGGCAGCCTCCAGGAGGG + Intergenic
1019887020 7:3913975-3913997 AAAGCAGGCACCATCAGGGAAGG - Intronic
1021759438 7:23889225-23889247 CAAGATGGCCCCATCCATCAGGG - Intergenic
1023279542 7:38555469-38555491 CTTGCAGGTACCATCAATGAGGG - Intronic
1023970453 7:44986954-44986976 CAGGAAGGCACCACCCATTAGGG - Intergenic
1026612450 7:71872222-71872244 CTAGCATGCACCCTCCATAAGGG + Intronic
1028916548 7:96265875-96265897 CAAGAAGGCACCATCTATGAAGG - Intronic
1032078988 7:128849319-128849341 CAGGCAGGCACCTGCCATGCGGG - Exonic
1034942128 7:155237440-155237462 CAGCCAGGCACCCTCCCTGAGGG + Intergenic
1037732236 8:21536198-21536220 CAAGAAGGCACATTCCATGGAGG + Intergenic
1042499864 8:69496998-69497020 CATGCGTGCACCATCCACGATGG + Intronic
1043239392 8:77913652-77913674 CAAGAAGTCACTACCCATGATGG - Intergenic
1044529824 8:93294246-93294268 AAAGCAGACACCATCCAACAGGG + Intergenic
1044743642 8:95352036-95352058 CAAGCAGGTACCAGCCATGTAGG + Intergenic
1046889097 8:119401360-119401382 GAAGAAAGCACCAGCCATGAGGG - Intergenic
1047922575 8:129650760-129650782 CTAGAAGGCACCATCTTTGAAGG + Intergenic
1051883865 9:21869441-21869463 GAAGCAGCAACCATCAATGAAGG - Intronic
1051991815 9:23161319-23161341 AGAGCAGGCACCAGCCATGATGG - Intergenic
1054809648 9:69424953-69424975 CAGGCAGATACCATCCATCAGGG + Intergenic
1057445287 9:95109966-95109988 CAGGCAGGCACCAGCAAGGAAGG + Intronic
1059588803 9:115635151-115635173 CAAGCAGGCACCTTGAAGGAGGG - Intergenic
1060520082 9:124289421-124289443 CAGGCTGGCACTATCCCTGAAGG + Intronic
1061453895 9:130683522-130683544 CCAGCATACACCAGCCATGAGGG + Intergenic
1061822564 9:133236643-133236665 AGTGCAGTCACCATCCATGAGGG - Intergenic
1193279116 X:79626498-79626520 CTAGCAGGGACTCTCCATGAGGG + Intergenic
1196903179 X:120406703-120406725 CAAGCTGGCACCCTCAAGGATGG + Intergenic
1198622981 X:138534362-138534384 AAAGCAGGGAACATCCATGATGG - Intergenic
1199354769 X:146849326-146849348 CAAGTGGGCACTATGCATGAAGG + Intergenic
1199440693 X:147864732-147864754 AAAGCAGGAACTATTCATGAAGG + Intergenic
1199658140 X:150018603-150018625 CAAGAAGGGACCATCTATAAAGG - Intergenic
1200804000 Y:7413476-7413498 CAAGAAGGCACCATCTCTGAAGG - Intergenic