ID: 1064821647

View in Genome Browser
Species Human (GRCh38)
Location 10:19342244-19342266
Sequence GTCAGTCGTTTTCAGTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064821647_1064821649 24 Left 1064821647 10:19342244-19342266 CCTGGGTACTGAAAACGACTGAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064821647 Original CRISPR GTCAGTCGTTTTCAGTACCC AGG (reversed) Intronic
905450183 1:38051192-38051214 GTCAGTCGTCATCAGCACCCTGG + Intergenic
923505152 1:234599506-234599528 GTCAGTTGTTAACAGTACTCTGG + Intergenic
1064821647 10:19342244-19342266 GTCAGTCGTTTTCAGTACCCAGG - Intronic
1069615144 10:69802029-69802051 GCCAGTCAGTTTCAGTCCCCGGG - Exonic
1070662912 10:78320319-78320341 CTCAGTCTCTTTCCGTACCCAGG - Intergenic
1086876797 11:92106826-92106848 GTAAGTCTTTTTCAATGCCCTGG - Intergenic
1092015727 12:5156662-5156684 CTCAGGCATTTTCAGTGCCCTGG - Intergenic
1092784069 12:12012015-12012037 GTCTGCAGTTCTCAGTACCCTGG - Intergenic
1095935139 12:47671789-47671811 CTCAGTGGCTCTCAGTACCCCGG - Intronic
1106197938 13:27510059-27510081 ATCAGTCTTTCTCAGTATCCAGG - Intergenic
1112474798 13:99721734-99721756 GTCACTTGTTTCCAGTTCCCAGG + Intronic
1116919603 14:50559356-50559378 CTTAGTTGTTTTCAGTAACCTGG - Intronic
1117511142 14:56452758-56452780 CTCAGTCCTTTTCAGGACCCTGG - Intergenic
1121834497 14:97079790-97079812 AAGAGTCGTTTTCAGAACCCAGG - Intergenic
1122297687 14:100714475-100714497 GCCAGGCCTTTTCAATACCCAGG - Intergenic
1123801206 15:23822992-23823014 GTCAGTTGTTTTCAGTAGTATGG + Intergenic
1124828047 15:33119292-33119314 GACAGTCCATTTCAGTTCCCAGG - Intronic
1136146937 16:28321399-28321421 TTCAGTCCCTTTCTGTACCCAGG - Exonic
1142993406 17:3746893-3746915 GTCTGTCATTTTCAATCCCCAGG + Intronic
1145057640 17:19713995-19714017 GTCAGCCGTTTCCACTGCCCGGG + Intronic
1150452608 17:65281473-65281495 GTGAGTGGTTTTCAGACCCCTGG + Intergenic
1151316782 17:73327649-73327671 GTCAGAAGTTTGCAGAACCCTGG - Intergenic
1159414924 18:68133472-68133494 TGCAGTATTTTTCAGTACCCTGG - Intergenic
1159441826 18:68490294-68490316 GTCAGTGTTTTTCAGAACTCTGG - Intergenic
1165811326 19:38613818-38613840 GTCAGTGGTTTTTCCTACCCTGG - Intronic
930442692 2:51428929-51428951 GTCTGTTGTTTTAAGCACCCAGG + Intergenic
940902783 2:159141475-159141497 CTCTGTCTTTTTCAGTTCCCAGG - Intronic
947499083 2:230659197-230659219 GTGAGTCAATTTCAGTACCTGGG + Intergenic
1168913566 20:1468669-1468691 GTTAGTCGTTGTCAGTTTCCAGG - Intronic
1169057682 20:2636941-2636963 TTCAGTGGTTTTCTGTACCTGGG - Intronic
1173123359 20:40314481-40314503 GTCAGGCTTGTTCAGTTCCCAGG - Intergenic
1175491208 20:59382231-59382253 GTCCGTCTTTGCCAGTACCCCGG - Intergenic
954828897 3:53401348-53401370 GTCAGTCCTTTTCATCACCCAGG + Intergenic
954916937 3:54156506-54156528 GTCAGTCTTTTTGAGTCCCTGGG + Intronic
961709721 3:128818835-128818857 GTCAGCCATGTTCAGTACCAGGG - Intergenic
965074138 3:163954398-163954420 TTCAGACTTTTTCAGCACCCAGG - Intergenic
971077797 4:23170050-23170072 GTCAGTTATATACAGTACCCTGG - Intergenic
978996327 4:115158823-115158845 ATCAGTAGTTTTCACTACACTGG + Intergenic
987701395 5:21404291-21404313 CTCACTCAGTTTCAGTACCCAGG - Intergenic
991965887 5:72090227-72090249 GTCAGTTGTTTTCTGTAACATGG - Intergenic
996293194 5:121879177-121879199 GTCAGTCATCTTCAGTACTCAGG + Intergenic
996860520 5:128060637-128060659 TTCATTCCCTTTCAGTACCCTGG - Intergenic
996863903 5:128096050-128096072 TTCAGTAGTTTTCTGTAGCCTGG + Intronic
1004277594 6:14252400-14252422 GTCTGTTGTTTTCAGCAGCCAGG - Intergenic
1008081946 6:47204158-47204180 GGCAGTGTTTTACAGTACCCAGG - Intergenic
1008628781 6:53344369-53344391 GTCAGGCCTTTTCACTGCCCTGG + Intronic
1010367913 6:75073735-75073757 GCCAGTCATTTTCAGTGCACTGG + Intergenic
1022351996 7:29574945-29574967 GTCAGTTCTTTTCAGTATACAGG + Intergenic
1025284861 7:57652955-57652977 GTCAGTGGTTTTCACTGCCGCGG - Intergenic
1025301105 7:57820308-57820330 GTCAATCGTTTTCACCGCCCCGG + Intergenic
1033131807 7:138751349-138751371 GTCACTCGTCTTCAGAGCCCAGG - Intronic
1040890856 8:52314626-52314648 TGCAGGCATTTTCAGTACCCTGG - Intronic
1055685124 9:78765046-78765068 GTCAGGCTTTTTTAGTCCCCAGG - Intergenic
1062516828 9:136941065-136941087 CTCAGTGGTCTTCAGTCCCCAGG - Exonic
1198390557 X:136169563-136169585 GTCATTTGTTTTGATTACCCGGG + Intronic
1199421351 X:147648406-147648428 GACAGTGGTTTTCAGTACTTGGG + Intergenic