ID: 1064821648

View in Genome Browser
Species Human (GRCh38)
Location 10:19342266-19342288
Sequence TAAGAACAAAGTAATGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064821648_1064821649 2 Left 1064821648 10:19342266-19342288 CCTGCGTCATTACTTTGTTCTTA 0: 1
1: 0
2: 0
3: 5
4: 155
Right 1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064821648 Original CRISPR TAAGAACAAAGTAATGACGC AGG (reversed) Intronic
905805549 1:40874400-40874422 TAAGAACTCAGTAAGGAGGCTGG + Intergenic
906581904 1:46941881-46941903 TAAGACAAAAGTAATGATTCAGG - Intergenic
906601809 1:47137016-47137038 TAAGACAAAAGTAATGATTCAGG + Intergenic
907790484 1:57658860-57658882 TAAGAGCAAAGCAAAGAGGCTGG - Intronic
908825663 1:68130713-68130735 AAAGAACAAAATAGTGTCGCTGG + Intronic
912723413 1:112038947-112038969 TGAGACCAAAGTATTGAAGCTGG - Intergenic
914929879 1:151921546-151921568 TTAGAACAAAGAATTGAGGCAGG + Intergenic
916299367 1:163256815-163256837 TAAGAACACAGTGATGAGGGTGG + Intronic
917284071 1:173406586-173406608 TAAGAACATAGCAATGAATCCGG - Intergenic
917990059 1:180366017-180366039 TAAGAACCAATTAATGATGAAGG - Intronic
922963226 1:229665668-229665690 TGAGGAAAAAGTAATGAAGCAGG - Intergenic
924126184 1:240854516-240854538 GAAGATCCAAGTAATGACTCAGG + Intronic
1064821648 10:19342266-19342288 TAAGAACAAAGTAATGACGCAGG - Intronic
1068487619 10:57679812-57679834 TGAGAATAAAGTACTGACACAGG - Intergenic
1072848196 10:98855940-98855962 TAAGCACAAGGTAATGATACAGG + Intronic
1074329431 10:112490000-112490022 AAAGAACAAGGTAATGACAATGG - Intronic
1075876276 10:125808548-125808570 TAAGAACTTAGCAGTGACGCTGG + Intronic
1078983226 11:16562292-16562314 TCAGAACCAAGGAATGACACTGG + Intronic
1080436824 11:32252648-32252670 TGAGAACAAAAGAATCACGCTGG + Intergenic
1082037188 11:47654475-47654497 TAAGAACAAAGGAAAGAGGGCGG + Intergenic
1084676004 11:70635040-70635062 AAAACAGAAAGTAATGACGCTGG + Intronic
1088386393 11:109262423-109262445 CAATAACAAAGTATTGACGGGGG - Intergenic
1092487729 12:8916582-8916604 TAAGAACCAAGCAAAGAGGCAGG - Intronic
1092559720 12:9599572-9599594 TAAGCACCAAGTGATGAGGCTGG - Intronic
1093292549 12:17346087-17346109 TAAGAATAAATTAATGAGCCAGG + Intergenic
1096901749 12:54890296-54890318 CAAGAACATATTAATGACCCTGG - Intergenic
1097922693 12:65093432-65093454 TAAGTAAAAAGTAATGAAGGAGG - Intronic
1098724845 12:73950628-73950650 TTTGAACAAAGAAATGAAGCTGG + Intergenic
1098968514 12:76822247-76822269 TAAGAAACATGTAATGATGCAGG + Intronic
1100651154 12:96590356-96590378 AAAGAACAAAGTTTTGAAGCAGG + Intronic
1100823357 12:98452662-98452684 CAAACACAAAGTTATGACGCAGG + Intergenic
1101092009 12:101296966-101296988 TAAAAACAAAGGAATGACAAGGG - Intronic
1102396336 12:112589242-112589264 TGAGAACAAAGTTAAGAGGCAGG - Intronic
1103380703 12:120491936-120491958 TCCGAACAGAGTAATGTCGCTGG - Intronic
1104266957 12:127242757-127242779 TAGGGACAAATTAATGAAGCAGG + Intergenic
1104931897 12:132344140-132344162 TTAGAACAAAGAAATCACCCTGG + Intergenic
1106670245 13:31897520-31897542 TAAAATAAAAGTAATGAGGCTGG - Intergenic
1107652992 13:42563364-42563386 TAAGAACAAAGAAGTTAGGCTGG + Intronic
1108208207 13:48112537-48112559 TAAGAACCAAGAAATGGGGCTGG + Intergenic
1108537207 13:51396157-51396179 TAATAAAAAAGTACTGACTCTGG - Intronic
1109859369 13:68177709-68177731 CAAGAAAAAAGTAATGAAGAAGG - Intergenic
1111432051 13:88158118-88158140 TAAGAAGAAAGTAATGTTGTTGG - Intergenic
1111771498 13:92601611-92601633 TAAGAACAATGTAATGCCTATGG - Intronic
1113659837 13:112098573-112098595 TAAGAACAAAGAACAGACACAGG + Intergenic
1114128502 14:19760299-19760321 TCTGAACAAAGGAATGACCCAGG - Intronic
1114908720 14:27164492-27164514 GAAGAACAAAGTTTTGATGCAGG - Intergenic
1116374996 14:44187770-44187792 TAAGAAGAAAATTATGACACTGG + Intergenic
1119686228 14:76633869-76633891 TAAGAACAAAGGCATCACGTGGG + Intergenic
1123571443 15:21614567-21614589 TCTGAACAAAGGAATGACCCAGG - Intergenic
1123608061 15:22057158-22057180 TCTGAACAAAGGAATGACCCAGG - Intergenic
1124898333 15:33798385-33798407 TAAAGACAAAGGAATGAGGCTGG - Intronic
1127196049 15:56587004-56587026 TAAGATCAAAGTAAAGGAGCAGG - Intergenic
1202980296 15_KI270727v1_random:348956-348978 TCTGAACAAAGGAATGACCCAGG - Intergenic
1132745656 16:1435151-1435173 TCAGAACCAAATAATGAAGCTGG - Exonic
1135346990 16:21697333-21697355 TAATAACAAATTAATGTGGCTGG + Intronic
1139401566 16:66685956-66685978 TAAGAACAAAGTTCTGGAGCCGG + Intronic
1142521494 17:507901-507923 TAAGAACAAAGCAGTGTCACTGG - Intergenic
1142946964 17:3437822-3437844 TAAAAACAAAGTAATTACACAGG + Intergenic
1143312961 17:6008605-6008627 AAAAAAAAAAGTAATGATGCTGG - Intronic
1144417314 17:15061648-15061670 AAAGAACAAACTATTGATGCAGG + Intergenic
1149183643 17:53971604-53971626 TAAGAACAAAGTAGCAAGGCTGG - Intergenic
1151103746 17:71587965-71587987 TAAGAACCAAGATATGAGGCAGG + Intergenic
1151772719 17:76175594-76175616 TAAGCAAAAAGTAATTAGGCAGG + Intronic
1153321672 18:3779561-3779583 CATGAACAAAGCAATGAGGCAGG - Intronic
1154196995 18:12274023-12274045 TAAGAGCAGAGTGATGACGTGGG + Intronic
1155705154 18:28801336-28801358 TAAGAACAAAGAAATCAGGCTGG + Intergenic
1156283851 18:35670878-35670900 AATGAACAAATGAATGACGCTGG + Intronic
1157288696 18:46394643-46394665 TCATAACAAACTAATGACCCTGG + Intronic
1157371934 18:47121764-47121786 TGAGAACAAAGTATTGTGGCAGG - Intronic
1159614438 18:70564627-70564649 AAAGAACTATGTAATGACACTGG + Intergenic
1161126708 19:2561880-2561902 TAAAAAAAAAGAAATGACACTGG + Intronic
1161174158 19:2830330-2830352 TATGAACAAAGCACTGACACAGG - Intronic
1165087804 19:33363545-33363567 TAAGAACAAAGTATACACACAGG + Intergenic
1168446614 19:56422669-56422691 TAAGAACAAAACAATGAAGGTGG - Intronic
928977775 2:37106745-37106767 TTAGAACAAAGAGATGAGGCTGG + Exonic
929033741 2:37671933-37671955 TAAGCACAAAGAAAGGTCGCCGG + Exonic
930461466 2:51683383-51683405 CAATACCAAAGTAATGAAGCAGG + Intergenic
933862066 2:86479783-86479805 TAAAAACGAATAAATGACGCAGG - Intronic
934506694 2:94900042-94900064 TAACAACATAGTAATGCCGGCGG + Intergenic
938302529 2:130227448-130227470 GAAGAAAAAACTAATGAGGCAGG - Intergenic
938454154 2:131446804-131446826 GAAGAAAAAACTAATGAGGCAGG + Intergenic
939581197 2:143948037-143948059 TAAGGAAAAAGTAAGGACTCTGG + Intronic
1171851734 20:30313601-30313623 CAAGAACAAAGTAGTAAAGCAGG - Intergenic
1174473563 20:50779334-50779356 TAATCACAAAGCAATGACACAGG - Intergenic
1175265172 20:57698532-57698554 AAAGAACAAAGAAATTACTCAGG + Intronic
1175428022 20:58882342-58882364 TAAAAACAAAAAAATGAGGCCGG - Intronic
1176133741 20:63509441-63509463 AAAGAAGAAAGCACTGACGCAGG - Intergenic
1178468580 21:32871346-32871368 TAACAAAAGAGTAATGACCCAGG - Intergenic
1182548059 22:31086911-31086933 TAAGCAGAAAGGAATGACGGGGG + Intronic
949987225 3:9550932-9550954 TGAGGACAAAGTCATGAGGCTGG - Intronic
952737582 3:36705755-36705777 AAAGAAAAAAGAAATGACGGTGG - Intergenic
955130057 3:56157292-56157314 AAAGAAAAAAGTAAAGAGGCTGG + Intronic
955341066 3:58125427-58125449 TAAAAACACAGTAATGTGGCTGG - Intronic
955841263 3:63115386-63115408 TAAGAATAAAGGAATGACTTGGG - Intergenic
957784834 3:84869032-84869054 AAAGAAAAAAATAATGACTCTGG + Intergenic
958738019 3:98032400-98032422 TAAGAGCAACGTATTGACTCTGG - Intronic
961210062 3:125118709-125118731 TGAGAACAAATAAATGACTCCGG + Intronic
963483671 3:145907931-145907953 TAAGAACAAAATAATTACTGGGG + Intergenic
964423314 3:156527883-156527905 TAAGAACAAAGTATGAATGCTGG - Intronic
965108931 3:164396179-164396201 AAAGGACAAAGCAATGATGCAGG + Intergenic
968466881 4:756550-756572 TAAGAACCAAATTATGAAGCTGG - Intronic
971790970 4:31169263-31169285 TTAGAAAAAAGTAATCAGGCTGG - Intergenic
976091479 4:81462442-81462464 TAAGAACAGAGTTATGTCACAGG + Intronic
981194058 4:141897823-141897845 TAAAAACAAAGTATTAAAGCTGG - Intergenic
982267168 4:153548597-153548619 TAATAATAAAGTGATGCCGCCGG - Intronic
982275579 4:153634302-153634324 TAAGAATAAAATAATGGCGTTGG - Intronic
986093269 5:4532213-4532235 TACGAACAAAGGCATGAAGCAGG + Intergenic
986768063 5:10946118-10946140 TATGAACAAAGGAATGGAGCCGG - Intergenic
986860624 5:11922776-11922798 TTAGAACAAGGTAATGAAGGTGG + Intergenic
986896226 5:12373043-12373065 TAATAACAAAAGAATGAAGCTGG - Intergenic
987654453 5:20788359-20788381 TAACAACATAGTAATTAAGCAGG - Intergenic
987994429 5:25257038-25257060 TAAGAAACAAGTAACGAAGCAGG + Intergenic
988741182 5:34073445-34073467 TAAAAACATAGTAATTAAGCAGG + Intronic
991677611 5:69103839-69103861 TAATAAAAAAATTATGACGCAGG - Intronic
993882334 5:93377984-93378006 TAAACACAAAGTGATGACTCTGG - Intergenic
996944656 5:129052246-129052268 AAAGAACAAAGTAATAAATCAGG + Intergenic
998391483 5:141789621-141789643 TATGAAGAAAGGAATGAGGCAGG + Intergenic
998520855 5:142799119-142799141 TAAGAGTAAAGTAATGCTGCAGG + Intronic
1004699519 6:18065850-18065872 AAAGAATAAAGTACTGACACAGG - Intergenic
1005275316 6:24210927-24210949 GAAGAACAAAGCCATGAGGCAGG - Intronic
1005449098 6:25955675-25955697 AAAGAAAAAAGTAAAGAAGCTGG + Intergenic
1005504915 6:26461148-26461170 TATGAACACAGTCATGATGCAGG - Intronic
1012735501 6:102935654-102935676 TAAGAAAAAATAAATGACACTGG + Intergenic
1013609252 6:111778788-111778810 TAAAAAGAAAGTAAGGAGGCTGG - Intronic
1018010406 6:159664960-159664982 TAAGAGCAAAAGAATGACACTGG + Intergenic
1018964165 6:168470731-168470753 ATAGAACAAAGTAATGTCACAGG - Intronic
1020636938 7:10707653-10707675 AAAGCACAAAGTAATGAAACAGG - Intergenic
1020851021 7:13352368-13352390 TAAGAAGAAAATAATGGGGCCGG - Intergenic
1021018187 7:15562200-15562222 AAAGAAAAAAGTGATAACGCAGG + Intergenic
1022752123 7:33240116-33240138 TAAAAACAAATTAATGACTATGG - Intronic
1026533240 7:71218530-71218552 TAAGTTCAAAGTAGTGACACAGG + Intronic
1026543529 7:71301279-71301301 TAAAAAAAAAGTAATCAGGCAGG - Intronic
1028899803 7:96084717-96084739 TAAGAAACAGGTAATGAGGCAGG - Intronic
1030855752 7:114555396-114555418 TGAGATCAAAGTAATGACAAGGG + Intronic
1032203167 7:129837705-129837727 TAGGAACAAAGAAAAGATGCAGG + Intronic
1032528144 7:132595525-132595547 TAAGAACAAGGTAATTATTCAGG - Intronic
1032638859 7:133742318-133742340 TAAGAAGAAATAAATGAAGCAGG - Intronic
1034038833 7:147855217-147855239 GAAGAACAAACTAATGAAGGGGG + Intronic
1035875252 8:3181856-3181878 TAAGAAAGAAGTAATGATGCTGG + Intronic
1037296659 8:17409160-17409182 TAAAAATAAAGTAATGAGGCTGG + Intronic
1047996256 8:130339299-130339321 TAAGAACAAATTTAAGACGCTGG + Intronic
1049505001 8:142991422-142991444 CAAGAACAAAGCAGTGACCCTGG + Intergenic
1050806213 9:9681877-9681899 CAAGAAGAAAGTAATAATGCAGG + Intronic
1051907018 9:22106847-22106869 TAACAACAAAGCTATGAAGCAGG + Intergenic
1052066032 9:24021442-24021464 TAAGCACAAAGTAATGCTGGAGG - Intergenic
1052911529 9:33886703-33886725 TAAGAACTTACTAATGACCCTGG + Intronic
1055209161 9:73768087-73768109 TACGAATAATGTAATGACACAGG - Intergenic
1055313638 9:75011238-75011260 GAAGAACATAGTAATGACTGTGG + Intronic
1057105376 9:92410230-92410252 TAAAAACAAAACAATGAGGCTGG - Intronic
1057817985 9:98309737-98309759 TGAGCACAAGGTAATGACCCTGG - Intronic
1059965689 9:119611202-119611224 GAAGAACACAGTCATGACACTGG - Intergenic
1060190838 9:121591475-121591497 CAAGAAAAAAGAAATGAGGCTGG + Intronic
1061685198 9:132270701-132270723 TAAGAATAAAGTGATTAGGCTGG - Intronic
1185755761 X:2651866-2651888 TGAGAACAAACTAATGGTGCTGG + Intergenic
1185840135 X:3381655-3381677 TAAGAATACAGTATTGAGGCCGG + Intergenic
1187240635 X:17509918-17509940 TAAGCACAATGTAGAGACGCTGG - Intronic
1187355489 X:18566450-18566472 TAAAAAGAAAGTAATGGGGCTGG - Intronic
1188880508 X:35486556-35486578 GAAGAACAAAGTCATGGGGCTGG - Intergenic
1189537529 X:41951382-41951404 TAAGAACAAAATTATGAATCAGG + Intergenic
1194023714 X:88725574-88725596 TGAGAACAAACTAATAACGGTGG - Intergenic
1199177047 X:144801442-144801464 TAAGCACAATGTAATGACAATGG - Intergenic