ID: 1064821649

View in Genome Browser
Species Human (GRCh38)
Location 10:19342291-19342313
Sequence CAATAACCATTTAAAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064821648_1064821649 2 Left 1064821648 10:19342266-19342288 CCTGCGTCATTACTTTGTTCTTA 0: 1
1: 0
2: 0
3: 5
4: 155
Right 1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG No data
1064821647_1064821649 24 Left 1064821647 10:19342244-19342266 CCTGGGTACTGAAAACGACTGAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064821649 Original CRISPR CAATAACCATTTAAAATCTA AGG Intronic
No off target data available for this crispr