ID: 1064821715

View in Genome Browser
Species Human (GRCh38)
Location 10:19343303-19343325
Sequence CTGAGGGAAAAATGCATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064821715_1064821720 -6 Left 1064821715 10:19343303-19343325 CCCTTCATGCATTTTTCCCTCAG 0: 1
1: 0
2: 4
3: 26
4: 408
Right 1064821720 10:19343320-19343342 CCTCAGTGGTTACCTAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064821715 Original CRISPR CTGAGGGAAAAATGCATGAA GGG (reversed) Intronic
900034330 1:394335-394357 CTGTGGGAAACCTGCATGATGGG + Intergenic
900055164 1:624227-624249 CTGTGGGAAACCTGCATGATGGG + Intergenic
900509594 1:3052257-3052279 ATGAGTGAAAAATGGATGGATGG - Intergenic
900895652 1:5481232-5481254 GTGAGGGAAAACTGTATAAATGG - Intergenic
901006622 1:6174824-6174846 CGGATGGATAAATGGATGAATGG + Intronic
901435127 1:9242896-9242918 TTGAGGAAAAAACGCTTGAAGGG + Intronic
902246201 1:15122468-15122490 CTGAGGACACAATGCATGCACGG + Intergenic
903138578 1:21325252-21325274 CTCAGAGAAAGATGCATGGAGGG - Intronic
904249959 1:29216137-29216159 CTGAGGGAGAAGAGCATTAAAGG + Intronic
905128169 1:35730762-35730784 CTGAGGCAGAATTGCTTGAACGG + Intronic
905383342 1:37580394-37580416 CTGAGGAAAAACAGCATAAAGGG + Intronic
905566084 1:38966135-38966157 CTGAGGTAAAAATGCAATAGAGG - Intergenic
906311261 1:44756245-44756267 AGGAGGGAAAAATGGATGCAAGG - Intronic
907066653 1:51490943-51490965 ATTAGGGAAAATTGGATGAAGGG + Intronic
907652165 1:56305597-56305619 GTGGGGGAGAAATGCTTGAAAGG - Intergenic
908469375 1:64428004-64428026 CTGAAGGAGAAACACATGAAGGG + Intergenic
909078237 1:71078861-71078883 CTGGGGGAAAAATACTTGATTGG + Intronic
909712071 1:78663017-78663039 AGGAGGGAAAAATGCATCCAGGG - Intronic
909974762 1:82032472-82032494 CAGATGGAAAAATGCATTATTGG - Intergenic
910146840 1:84089858-84089880 CTGATGGATAAATGGATGAGAGG - Intronic
910225623 1:84933056-84933078 ATGAGGGAAAAATGTAGGGATGG - Intronic
910766208 1:90785019-90785041 CTGAGGTAAACAAGCATAAATGG + Intergenic
910815608 1:91288635-91288657 CTGAGGGTTAAATGGATTAAGGG - Intronic
911198653 1:95021500-95021522 CTGAGGAAAAAATAAAAGAAGGG - Intronic
911730492 1:101287647-101287669 CTTAGGGAAAAATAAATGGAGGG + Intergenic
913708729 1:121456385-121456407 TGGAGGGAAAAAGGGATGAAGGG + Intergenic
914881940 1:151554115-151554137 TTGTGGGAAAACTGGATGAAGGG - Intronic
914933227 1:151953303-151953325 CTGTGTGGGAAATGCATGAAGGG + Intergenic
914959685 1:152195731-152195753 CTGAGGGTTAAATGGATTAAGGG - Intergenic
915484847 1:156213053-156213075 GTGAGGAAAAAAGGCATGAGGGG + Exonic
916519027 1:165546608-165546630 CTCAAGGAAAAGTGCATGTATGG - Intronic
916562681 1:165946904-165946926 TTGAGGGGAAAATACATCAAAGG + Intergenic
916970273 1:170006248-170006270 TAGAGGGATGAATGCATGAAAGG - Intronic
917514079 1:175692472-175692494 CAGATGGAAAGATGGATGAAGGG - Intronic
917627875 1:176863987-176864009 CTCAGGGAAAAAAAAATGAATGG + Exonic
918140369 1:181714714-181714736 CTTAGGGACAAATTCATGATTGG + Intronic
918300315 1:183198049-183198071 ATGAGGGACACATGCAGGAAAGG + Intronic
918753319 1:188302143-188302165 TTGAGTGAAAAAGGAATGAATGG + Intergenic
919090855 1:192977748-192977770 GTGTGGGAAAGAGGCATGAATGG - Intergenic
919552721 1:199011977-199011999 CTGAGTGAAAAGTGCACAAATGG + Intergenic
919700918 1:200630105-200630127 CTGAGGGAAAACTGAAGAAAGGG + Intronic
920187049 1:204166282-204166304 CTGAGGGAAGCATGGATGGATGG - Exonic
920377127 1:205514956-205514978 CCGAGGGAAAAATTGAGGAAGGG + Intronic
921513484 1:216061185-216061207 CTGATAGACAAATTCATGAATGG + Intronic
921567635 1:216739218-216739240 CTGAGAGACAAGTGCATAAAAGG + Intronic
921776760 1:219110295-219110317 CTGAGATATAAAGGCATGAAAGG - Intergenic
921786564 1:219237957-219237979 ATGAAGGAAAAATAAATGAATGG + Intergenic
922044076 1:221926776-221926798 GTGAGCCAAAAATGCAGGAATGG + Intergenic
922143317 1:222912296-222912318 TTGAGAGAAAAATACATAAACGG - Intronic
922873949 1:228925369-228925391 CTAAGGGGAAAATGCCTCAAGGG + Intergenic
923422519 1:233832390-233832412 ATATGAGAAAAATGCATGAAGGG - Intergenic
923999829 1:239538282-239538304 CTGAGGGAAAAAGAAAGGAAAGG - Intronic
924337891 1:243001385-243001407 CTGTGGGAAACCTGCATGATGGG + Intergenic
1064200743 10:13282918-13282940 CTGGTGGAAATATGAATGAATGG + Intronic
1064821715 10:19343303-19343325 CTGAGGGAAAAATGCATGAAGGG - Intronic
1065201844 10:23319987-23320009 CTGATTGCTAAATGCATGAATGG - Intronic
1065338972 10:24685106-24685128 TTGAGGAAGAAATACATGAATGG - Intronic
1066058863 10:31705215-31705237 CTGATGAACAAATGAATGAATGG - Intergenic
1068139608 10:52989032-52989054 TTGAGGGAAAAATGCTTCTAAGG - Intergenic
1068255566 10:54505319-54505341 CTTAGGGCAAAATGAAAGAAAGG + Intronic
1073609181 10:104926396-104926418 TTTAGGGGAAAATGTATGAAAGG + Intronic
1074586739 10:114775112-114775134 GAGAGGGAAAAATGCAAGCAGGG + Intergenic
1076038365 10:127220780-127220802 CAGAGGGAAAAATCAATTAAAGG - Intronic
1078189919 11:9085326-9085348 ATTAGGGTAAAATGAATGAAGGG + Intronic
1079250258 11:18781803-18781825 TTGAGTGAGAAATGCATTAAAGG + Intronic
1080057170 11:27918189-27918211 TTCAGGGAAATATGCAGGAATGG + Intergenic
1080344058 11:31301913-31301935 CACAGAAAAAAATGCATGAAAGG - Intronic
1081245339 11:40759336-40759358 CTGAGGTAAAAATGTGTGAAGGG - Intronic
1081436912 11:43036838-43036860 CTGTGTGAAAAATGGATGTAAGG + Intergenic
1081976168 11:47236369-47236391 CTTAGGCAAAAAGGCATCAAAGG - Intronic
1084082838 11:66840235-66840257 CTGAGGGACAAAGGCCAGAAAGG - Intronic
1084161420 11:67352595-67352617 CTGAGGGAGAAATGGATGGAGGG - Intronic
1084409228 11:68996880-68996902 CTGAGGTATAAATGCAGGATGGG + Intergenic
1084579170 11:70011942-70011964 TAGATGGAAAAATGGATGAATGG - Intergenic
1084873363 11:72112591-72112613 CTGGGGGAAAAAGGAATGAAGGG + Intronic
1086387782 11:86327174-86327196 ATGATTGAAAAATGAATGAAAGG + Intronic
1086827824 11:91521220-91521242 CTGAGGAAGAAAAGCAAGAAGGG - Intergenic
1087728489 11:101751525-101751547 CTGAGTGAATAATGAGTGAATGG - Intronic
1088000273 11:104871174-104871196 ATGAGGGAAAAGTGGAGGAATGG + Intergenic
1088218115 11:107536639-107536661 CTGAGGGAACCCTGAATGAAAGG + Intronic
1089107212 11:116022758-116022780 CTGAGAGAAAAATTAAAGAAAGG - Intergenic
1089369489 11:117944914-117944936 CTTGGGGAAAAATGAATTAATGG + Intergenic
1089505517 11:118959369-118959391 CTGAGGGAAAAAGGCAGGAGTGG + Intergenic
1090512344 11:127388861-127388883 GTGAGGGAATAATGCATGAATGG - Intergenic
1091530464 12:1350072-1350094 ATGAGGGAAAAATTCATCATGGG + Intronic
1092037284 12:5347557-5347579 CTGACGGCAAAACGCTTGAATGG - Intergenic
1092445495 12:8552633-8552655 ATAAGGGAAAACTGCATAAAGGG + Intergenic
1092652746 12:10652287-10652309 ATGAGGGAGAAATGAATGAAGGG - Intronic
1093385166 12:18544140-18544162 CTGAGAGAAAAATGTATGTGTGG + Intronic
1094490793 12:30959375-30959397 CAGAGAGAACAATGCGTGAAAGG + Intronic
1096044688 12:48552222-48552244 CTCAGGGTTAAATGCATTAAGGG + Intergenic
1096295110 12:50377196-50377218 ATGACGGACAAATACATGAATGG + Intronic
1096407537 12:51354740-51354762 CTGAGAGAAAAATGCTTTCAGGG + Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1097629773 12:62045992-62046014 CTGAGGGAAAATAAGATGAATGG + Intronic
1097779663 12:63687323-63687345 CTGAGGGTTAAATGGATTAAGGG + Intergenic
1098047700 12:66419052-66419074 CTGAGAGATAAATGGATAAAAGG + Intronic
1098371936 12:69768835-69768857 CTAAGACTAAAATGCATGAATGG + Intronic
1098808039 12:75045929-75045951 TTGAGGGATAAATAAATGAAAGG + Intronic
1099167974 12:79329920-79329942 AAGAGGGATAAATGCAAGAAAGG - Intronic
1099712246 12:86242682-86242704 GAGAGGGAAAAATGGAGGAAGGG + Intronic
1099771409 12:87063229-87063251 CAGAGGGAAATATGGATAAATGG + Intergenic
1101498181 12:105275831-105275853 CTGAGAGAGAAAGGCATTAAGGG - Intronic
1101525067 12:105521146-105521168 CTGAGGGAAAAAAGAATCATTGG + Intergenic
1101709587 12:107252727-107252749 CTGAGGGAAGAAAGGAGGAAAGG - Intergenic
1101827846 12:108234373-108234395 CTGGGGGAGAAAAGCAAGAAGGG + Intronic
1102939028 12:116922219-116922241 CTGGGGGAAAAAGGTCTGAAAGG - Intronic
1103056609 12:117826048-117826070 TGGATGGATAAATGCATGAATGG + Intronic
1103350023 12:120277753-120277775 CTCAGGGTTAAATGCATTAAGGG - Intergenic
1103449887 12:121021229-121021251 CTGAGAATAAAATGCATTAAGGG - Intronic
1103632329 12:122271599-122271621 TTGAGGGGAAAATACATCAAAGG + Exonic
1103688462 12:122751644-122751666 CTGAGGGTTAAATGGATTAAGGG - Intergenic
1104427698 12:128691774-128691796 CTGAGGGACAGACACATGAATGG - Intronic
1104505930 12:129332159-129332181 CTGAGGGAAAAGGTCATTAAAGG - Intronic
1104616700 12:130276460-130276482 GTGTGGGTAAAATGCACGAAAGG - Intergenic
1104764003 12:131314813-131314835 ATAATGGAAAAATGAATGAATGG - Intergenic
1105314324 13:19243445-19243467 CTGAGGGAAAAATGGCAGATGGG + Intergenic
1107140070 13:36988868-36988890 ATGAGGGAAAAATAAATAAATGG + Intronic
1107649364 13:42528673-42528695 ATTATGGAAAACTGCATGAAGGG - Intergenic
1107778335 13:43872222-43872244 AGGAGGGAAGAATACATGAAGGG - Intronic
1110466598 13:75808709-75808731 TTGATGTTAAAATGCATGAATGG + Intronic
1110711416 13:78655123-78655145 CTCATGGCAAAATGCATGCACGG + Intronic
1111803994 13:93015733-93015755 CTGAGTGAAAAAAACATGTAAGG + Intergenic
1112277330 13:98033545-98033567 CTGAGGGAAAAATGCTTATGTGG + Intergenic
1112449415 13:99495442-99495464 GTGGGGGGAAAATTCATGAAAGG - Intergenic
1113173938 13:107538963-107538985 TTGAGAGCAAAATGAATGAATGG - Intronic
1114202422 14:20534800-20534822 CAGAGGGAAAAAAGTATGGAGGG - Intergenic
1115093637 14:29608447-29608469 ATAAGGGAAAGATGAATGAAAGG + Intronic
1115493823 14:33984046-33984068 CTCAGGGTAAAATGGATTAAGGG - Intronic
1117102934 14:52369118-52369140 CTGAGGGAAAAAAACATTGAAGG + Intergenic
1117714274 14:58564416-58564438 TTGGGTGAAAAATACATGAAAGG + Intergenic
1119232881 14:72994706-72994728 CTGTAGGAAAAATGTCTGAAAGG - Intronic
1119730442 14:76947668-76947690 ATAGGGAAAAAATGCATGAAAGG - Intergenic
1121060096 14:90899102-90899124 CTGAGTGAGAAAAGCATGAGAGG + Intronic
1121687612 14:95849574-95849596 CTGAGGCATAAATGCTGGAAAGG + Intergenic
1122601018 14:102922027-102922049 GTGAGTGAAAAATGAATGAATGG - Intergenic
1123496507 15:20832579-20832601 ATGGGGGAAAAAAGAATGAAAGG - Intergenic
1123553745 15:21406169-21406191 ATGGGGGAAAAAAGAATGAAAGG - Intergenic
1123580611 15:21712138-21712160 CTGAGAGTATAATGTATGAATGG - Intergenic
1123589986 15:21843534-21843556 ATGGGGGAAAAAAGAATGAAAGG - Intergenic
1123617259 15:22154761-22154783 CTGAGAGTATAATGTATGAATGG - Intergenic
1125145826 15:36467176-36467198 CTGAGAGAGCAATGCATGATTGG - Intergenic
1125820773 15:42628441-42628463 CTAAAGCAAAAATGGATGAATGG - Intronic
1125978985 15:43982584-43982606 CTGGGGGAAAAATGCCACAAAGG - Intronic
1126435940 15:48637570-48637592 ATGAGTGAAAAATACATCAAGGG - Intronic
1128619279 15:69135114-69135136 CTCAGGGAAGACTTCATGAAAGG - Intergenic
1128793401 15:70449113-70449135 TTGAGGGATGAATGGATGAAGGG + Intergenic
1130127422 15:81105392-81105414 GTGAGGGAAGAATGGAGGAAGGG - Intronic
1131287165 15:91069857-91069879 GTGAGGGAACAATGCTTCAAGGG - Intergenic
1131925876 15:97383347-97383369 CTGAGGGAGAAAGGAAGGAAGGG + Intergenic
1202962090 15_KI270727v1_random:133365-133387 ATGGGGGAAAAAAGAATGAAAGG - Intergenic
1202989481 15_KI270727v1_random:446383-446405 CTGAGAGTATAATGTATGAATGG - Intergenic
1132785459 16:1654836-1654858 CTGAGGGAGAAGTACATGAGCGG - Intronic
1133258012 16:4530047-4530069 CTGAGGGAAAATTGCTGGAGGGG - Intronic
1133618605 16:7503979-7504001 CACGGGGAAAAATGGATGAACGG + Intronic
1133638317 16:7691730-7691752 CTTAGGGAAAATTGCAGAAAGGG + Intronic
1134264957 16:12684810-12684832 CTGCTGGATAAATGAATGAATGG + Intronic
1134755865 16:16666743-16666765 CTGAAAGAAAAATGCAGGAATGG + Intergenic
1134798830 16:17066012-17066034 CTTACGGAAAAATGCAGAAATGG - Intergenic
1134990201 16:18692422-18692444 CTGAAAGAAAAATGCAGGAATGG - Intergenic
1135376273 16:21950074-21950096 ATGACAGAAAAATGCATGAATGG + Intergenic
1135483983 16:22847396-22847418 CCTAGTGAAAAATGCAAGAAAGG + Intronic
1136071434 16:27789940-27789962 ATGAATGAAAAATGGATGAATGG + Exonic
1136360285 16:29775022-29775044 CAGAAGGAAAAAGGCATGGAGGG + Intergenic
1139013793 16:62665264-62665286 CTGAGGTCAACATGCATTAAGGG - Intergenic
1140619177 16:76707204-76707226 TTGAAGGATAAATGCTTGAAGGG + Intergenic
1141854897 16:86674117-86674139 TTGAGGGATGAATGAATGAATGG - Intergenic
1141878736 16:86844294-86844316 CGGAGTGGAAAATGCATGGAAGG - Intergenic
1142620157 17:1160518-1160540 ATGAATGAAAAATGAATGAACGG - Intronic
1145799779 17:27675645-27675667 CTGGGGGAAGAATGGATGAATGG - Intergenic
1146925584 17:36742658-36742680 CTGAGGGAAAATGGAAGGAACGG - Intergenic
1147901345 17:43787337-43787359 CTGGGAGAAAAATACATGCAAGG - Exonic
1150396083 17:64823048-64823070 CTGATGAAAAAAGGCATAAAGGG + Intergenic
1153363998 18:4233095-4233117 ATGAGGGGAAGATGGATGAAAGG - Intronic
1154072551 18:11165865-11165887 CTGAGGGAACAATGTGTGCAGGG + Intergenic
1154116247 18:11614734-11614756 CTCAGGGATAAATGGATTAAGGG + Intergenic
1154328600 18:13410844-13410866 TTCAGGGCAAAATGCAGGAATGG + Intronic
1154454424 18:14508262-14508284 ATGGGGGAAAAAAGAATGAAAGG - Intronic
1155805416 18:30165044-30165066 TTGAGTGAACAATGCATGAGTGG - Intergenic
1156614339 18:38765724-38765746 TGGAGGGAGAAATGCAGGAAAGG - Intergenic
1156825951 18:41430150-41430172 GTGAGGGAAGAATACAGGAAGGG + Intergenic
1156972504 18:43173091-43173113 GTAAGGGAAAAATGCCTCAAGGG + Intergenic
1158244571 18:55416943-55416965 CTGAGAGTGAAATGCAAGAAAGG + Intronic
1159324313 18:66894657-66894679 CTCAGGGTTAAATGCATTAAGGG + Intergenic
1159670729 18:71217669-71217691 GTAAGGGAAAAATGCCTCAAAGG - Intergenic
1160206527 18:76838369-76838391 CTGAGAGATAAAGGCATTAAAGG - Intronic
1162265346 19:9569088-9569110 CAGAGGGAAAGATACATCAATGG + Intronic
1163495134 19:17642004-17642026 CAGATGGACAAATGGATGAATGG - Intronic
1164043074 19:21510836-21510858 CTCAGGGTAAAATGGATTAAGGG - Intronic
1164856285 19:31527219-31527241 CTGAGGGATAAATGAAAGAGAGG - Intergenic
1166008161 19:39921581-39921603 CTGACGGAAAAAAAAATGAAAGG + Intronic
1166529414 19:43533725-43533747 CTGAGGGAAAAGTCCATTAGGGG + Intronic
1167906752 19:52666853-52666875 CTGAGGGAAAAAGACATAATGGG + Intronic
1168330968 19:55568309-55568331 CTGATGGATAAATGGGTGAATGG + Intergenic
1168460130 19:56547693-56547715 CTGGGTGATAAAGGCATGAAAGG - Intronic
925320767 2:2965836-2965858 TTGACTGAAAAATGCATGCAGGG + Intergenic
925925625 2:8668102-8668124 TGGATGGAAAAATGGATGAAGGG + Intergenic
926192451 2:10738999-10739021 CTGTGGGGCAAATGAATGAAAGG - Intronic
926765332 2:16318795-16318817 CTGAGGGAAAAAGGCATCTGTGG - Intergenic
928696502 2:33854965-33854987 GTGGGGGATAAAGGCATGAAGGG + Intergenic
929579763 2:43074425-43074447 ATTAGGGAAGACTGCATGAAGGG + Intergenic
929970893 2:46574789-46574811 ATGTCAGAAAAATGCATGAAAGG + Intronic
930363693 2:50412052-50412074 CTCAGGGTTAAATGGATGAAGGG + Intronic
930642616 2:53869580-53869602 CTGAGGGAATAATGGAGGATAGG + Intronic
931159793 2:59676377-59676399 CTGAGTGATAAATGTATGTATGG + Intergenic
932785106 2:74593931-74593953 GTGAGGAAGAAATCCATGAAAGG + Intronic
933142036 2:78803232-78803254 CAGAGGGAATAGTGTATGAAAGG + Intergenic
934607116 2:95704454-95704476 ATGAGGGAAAAAGTCATGCAGGG + Intergenic
935120576 2:100180288-100180310 CTGAGTGATACATGGATGAATGG + Intergenic
936540514 2:113346610-113346632 ATGAGGGAAAAACTCATGCAGGG + Intergenic
938241746 2:129747710-129747732 CTGAGACCAAAATGCATGCATGG - Intergenic
938823198 2:134978981-134979003 CTGAGAGAAATAAGCATGGAGGG - Intronic
939293960 2:140232742-140232764 TTGATGGAAAAATGATTGAATGG - Exonic
940577169 2:155523543-155523565 GTAAGAGAAAAATGCTTGAAGGG - Intergenic
940882319 2:158959132-158959154 CTGAGGGAGAATGGCATGGAAGG + Intergenic
942188714 2:173449409-173449431 CAAAGGAAAAAATGCTTGAAGGG + Intergenic
943540226 2:189204619-189204641 CTAAAGGAAAAATGAATTAAAGG - Intergenic
943742264 2:191422475-191422497 CTGAGGGAAAAATACACTAATGG + Intronic
943876515 2:193073326-193073348 CTGGGGCAAAAAAGCAAGAAGGG - Intergenic
943894767 2:193342218-193342240 CTGAGGGAATAATGGGAGAACGG - Intergenic
946051939 2:216870293-216870315 TTGAGGGGAAAATACATGAAAGG - Intergenic
946464197 2:219896949-219896971 TTGATGGAAACATGCATGGATGG + Intergenic
947237882 2:227962819-227962841 GTAAGGGAAAAATGCCTCAAGGG + Intergenic
1169157906 20:3349375-3349397 CTGTCTGAAAAATGAATGAATGG + Intronic
1169587457 20:7101955-7101977 GTAAAGGAAAAATGGATGAATGG + Intergenic
1169834649 20:9864752-9864774 CAGAGGGAAAAACCCATGGAGGG - Intergenic
1172194156 20:33080744-33080766 CTGATGGAAAGATGAATGGATGG + Intronic
1172343317 20:34176768-34176790 CTGAGGAACAACTGCATGATGGG + Intergenic
1173791126 20:45828408-45828430 CAGATGGAAAAATGTATGGAGGG + Intronic
1174409250 20:50322871-50322893 CTGATGGACAGATGGATGAATGG - Intergenic
1174734469 20:52952522-52952544 ATGTGGGACAAATGCTTGAAGGG - Intergenic
1175664686 20:60848399-60848421 TTTAAGGATAAATGCATGAAAGG - Intergenic
1175772668 20:61633437-61633459 CTGATGGATAGATGGATGAATGG - Intronic
1176819747 21:13645040-13645062 ATGGGGGAAAAAAGAATGAAAGG + Intergenic
1178390087 21:32191158-32191180 CCAGGGGATAAATGCATGAATGG + Intergenic
1178751447 21:35307927-35307949 CTAAGAGAAGAATGCATGACTGG - Intronic
1180152993 21:45961603-45961625 AGGAGGGAAAAATGCATTCATGG - Intergenic
1180224160 21:46379813-46379835 CTGAGGGCACAATGCACGCAGGG - Intronic
1180528208 22:16319010-16319032 CTAATGGAAAAATGAAAGAAGGG - Intergenic
1182664438 22:31946674-31946696 ATGGGGGAAAAAGGCAAGAATGG + Intronic
1183009152 22:34930557-34930579 CTGAGGCAGAATTGCTTGAATGG + Intergenic
1184982786 22:48106119-48106141 CTGAGAGAAAACTGAATGAATGG + Intergenic
1185050189 22:48550373-48550395 CTGTGGGAAAGGTGCATGAGAGG - Intronic
1203321546 22_KI270737v1_random:68035-68057 CTAATGGAAAAATGAAAGAAGGG + Intergenic
949327846 3:2887184-2887206 CAGAGGGAAAAATGTAGCAAGGG + Exonic
949402032 3:3675192-3675214 CAGAGAGAGAAATGCATGATGGG + Intergenic
949547198 3:5082373-5082395 CTCAGGGTTAAATGGATGAAGGG - Intergenic
949642480 3:6053850-6053872 CTGCGGGAAGAATGCATTTAGGG + Intergenic
951415293 3:22415866-22415888 CTGAGGTAAATATGCACTAAAGG + Intergenic
951448330 3:22807964-22807986 CTGAGGGAAATAACCATTAAAGG + Intergenic
952345819 3:32484098-32484120 CTGAGGAAAAAAAGGAGGAAAGG + Intronic
953537626 3:43788197-43788219 CAGAGGGATAAAGGCATAAAGGG - Intergenic
953706218 3:45232801-45232823 CTGAGGTTAGAAGGCATGAAAGG - Intergenic
955471292 3:59289028-59289050 TGGAGGGAAAACTGGATGAATGG - Intergenic
955597191 3:60604464-60604486 CTGCGGCAAAAATGCATGTCTGG - Intronic
955905343 3:63801840-63801862 CAGAGGGAAACATACCTGAAGGG - Intergenic
956464308 3:69503728-69503750 CTGATGGAAGCATGCATGATGGG - Intronic
957389687 3:79548126-79548148 CTGAGAGAAAAATGCTTGTTAGG + Intronic
957932271 3:86896576-86896598 CTGAATGAAAAATGACTGAATGG + Intergenic
957989494 3:87611419-87611441 CTGGGGGAAAAAGGCATAATGGG - Intergenic
958634265 3:96722688-96722710 CTGTGGGCTAAAAGCATGAAAGG + Intergenic
958699668 3:97571990-97572012 CTGAGGGAAAAAAGTAAAAATGG - Intronic
959425570 3:106183459-106183481 CTGAAGTAAAAATGCCTGCATGG - Intergenic
960500178 3:118428539-118428561 CTGATGGAAAAATGGGGGAAAGG + Intergenic
960517445 3:118617893-118617915 ATTAGGGAAAACTGGATGAAGGG - Intergenic
960775934 3:121253355-121253377 GTGAGAGAAAAATGTATGGAAGG - Intronic
960967297 3:123114250-123114272 CTGAGCGAAGAATGAGTGAAAGG + Intronic
961498191 3:127309435-127309457 CTAAGGGATAAATGGATTAAGGG + Intergenic
961572106 3:127806547-127806569 CTGAAGGATAAATGAATGTATGG + Intronic
961719260 3:128881583-128881605 ATTAGGGACAAATGCCTGAATGG - Intronic
962056639 3:131879322-131879344 CTTAGGGAAAAAGTCATTAATGG - Intronic
962980758 3:140487338-140487360 TTGAGGGAAAAATGGCTGAGAGG - Intronic
963178355 3:142325682-142325704 CTAAAGCAAAAATGCATAAACGG - Intronic
964390134 3:156188061-156188083 CTGAGGGAACAATGTGTGAAAGG - Intronic
964907796 3:161739360-161739382 TTGAGGGAAAAAAATATGAAAGG - Intergenic
964910061 3:161770318-161770340 CTGGGGGAAAAAAGCCTGACTGG + Intergenic
965232002 3:166066129-166066151 CTGTGGGGACAATGCATGAGAGG + Intergenic
965329007 3:167346218-167346240 ATGAGGCATAAATGCATGAGAGG - Intronic
965348921 3:167588949-167588971 CTGAAGAAAAAATGGATGAGTGG - Intronic
966160323 3:176960784-176960806 CTCAGGGAAATATTCAAGAACGG + Intergenic
968156650 3:196386115-196386137 CTAAGGGTTAAATGGATGAAGGG + Intronic
969206484 4:5651120-5651142 CGGAGGGATAGATGAATGAATGG + Intronic
970477774 4:16441000-16441022 CTAAGGGAAAAAAGAAAGAAAGG - Intergenic
972018372 4:34275538-34275560 CAGTGGGCAAATTGCATGAATGG - Intergenic
972304859 4:37821031-37821053 CTCAGGGATAAATGGATTAAGGG + Intergenic
973125479 4:46578584-46578606 TTGATAGAAAAATGCAGGAAGGG + Intergenic
975134373 4:70860273-70860295 ATTAGGAAAAAAGGCATGAAGGG + Intergenic
976852736 4:89567281-89567303 GTTAGGGAAAAAAGAATGAAAGG - Intergenic
977978330 4:103293508-103293530 CTGAGGCAAAAATGGCAGAAGGG + Intergenic
978608733 4:110512063-110512085 CTGAATGAAGAATGAATGAATGG - Intronic
979188583 4:117830954-117830976 CTGAAGGAAAAATGAAGTAATGG - Intergenic
979224601 4:118269999-118270021 CAGAAGGAAAAATGAATGCAGGG - Intergenic
979239246 4:118433947-118433969 CTGTGGGAAACCTGCATGATGGG - Intergenic
980021080 4:127711065-127711087 CTGTTGGAAAACTGCACGAATGG - Exonic
981634183 4:146856188-146856210 GTGAGAGAAAAATGAAGGAAAGG - Intronic
981666338 4:147231119-147231141 CTGAGGGAAAGAATAATGAAGGG - Intergenic
982463133 4:155695988-155696010 CTGGGGGAAATATGCTGGAATGG + Intronic
983710698 4:170712473-170712495 ATGAGAGAAATGTGCATGAATGG - Intergenic
984013724 4:174401951-174401973 CTGAGGGAAAAAATGATGACAGG + Intergenic
984521031 4:180801128-180801150 ATGAGGGACATATGCATGTATGG - Intergenic
985483808 5:137608-137630 GGGAGGGCAAAAGGCATGAAAGG + Intergenic
985529596 5:426199-426221 CAGATGGAAAGATGGATGAATGG + Intronic
985529630 5:426377-426399 CAGATGGAAAGATGGATGAATGG + Intronic
986357788 5:6945560-6945582 CAGAGGGCAAATTGCATGCAAGG + Intergenic
987139877 5:14934220-14934242 CTGAGGGGAAAATGCAAAGAGGG - Intergenic
987377054 5:17245740-17245762 CTGAAGGAAAAATGGAGAAAGGG + Intronic
987380134 5:17277283-17277305 CTGGGGAAAAAATGAATGACAGG + Intergenic
987933900 5:24438660-24438682 CTGAGGAAAAATTGCACGAAAGG - Intergenic
987987994 5:25174909-25174931 CTGAGGGAATATTACATGAAGGG + Intergenic
989427439 5:41312897-41312919 CAGAGGGAAAAATGGTTGAGGGG - Exonic
989680894 5:44028684-44028706 CTGAGGGAAAAAGGGAGGATGGG - Intergenic
989991616 5:50774094-50774116 CTCAGGGTTAAATGCATTAAGGG - Intronic
990059218 5:51626889-51626911 CTAAGAAAAAAATACATGAAAGG + Intergenic
991764254 5:69957945-69957967 CTGAGGGAAAAATGGTTTCATGG + Intergenic
991783073 5:70160202-70160224 CTGAGGGAAAAATGGTTTCATGG - Intergenic
991843486 5:70833017-70833039 CTGAGGGAAAAATGGTTTCATGG + Intergenic
991875515 5:71160529-71160551 CTGAGGGAAAAATGGTTTCATGG - Intergenic
994150145 5:96438282-96438304 CCCAGGGAAAGCTGCATGAACGG - Intergenic
994329220 5:98486679-98486701 ATGGTGAAAAAATGCATGAAGGG + Intergenic
994677547 5:102844317-102844339 CATAGGGGAAAATGAATGAAGGG + Intronic
995166042 5:109042785-109042807 CAGAGGGAAAAATGTAGAAAAGG + Intronic
995580392 5:113594233-113594255 GGGAGGGAGAAATGCAGGAAAGG - Exonic
995707510 5:115000366-115000388 CAGGGGGAAAAATGAAAGAAAGG + Intergenic
995932575 5:117465891-117465913 CTGAAGGAAAAATGGACAAATGG - Intergenic
996051381 5:118937856-118937878 GTGAAGCCAAAATGCATGAAAGG - Intronic
997705438 5:135947222-135947244 ACAAAGGAAAAATGCATGAAGGG - Exonic
997899293 5:137749972-137749994 CTAAGTTAAAAATGGATGAATGG + Intergenic
998393826 5:141805579-141805601 CTGAGGGAAAGAGGCAAGAGTGG + Intergenic
999252171 5:150189272-150189294 CTGAGGCAACAATGCATGGGCGG + Intergenic
999772279 5:154784650-154784672 CTGAGGGACCTGTGCATGAAAGG - Intronic
1001446143 5:171785289-171785311 CTGGGGGAAAAATTCATAGAGGG + Intergenic
1002257291 5:177967402-177967424 CTGAGGGAAAAGAGAATAAAAGG + Intergenic
1002671419 5:180870646-180870668 CTAAGGGAAAATTACAAGAAAGG + Intergenic
1002739490 5:181424533-181424555 CTGTGGGAAACCTGCATGATGGG - Intergenic
1004374119 6:15076821-15076843 ATAAGGGAAAACTGCATGCAGGG + Intergenic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1005448793 6:25953296-25953318 CTTAGTGAAAACTGAATGAATGG - Intergenic
1006287133 6:33105190-33105212 CAGAGGGAATTATGCATGCAAGG + Intergenic
1006707937 6:36038097-36038119 CTGTGGAGAAAATGCAAGAAGGG + Intronic
1006976326 6:38105696-38105718 CTTGGGGAAAACTGGATGAAGGG + Intronic
1007651594 6:43425731-43425753 CTGAGGGTTAAATGGATTAAGGG + Intergenic
1008044618 6:46838957-46838979 CTGAGGGAAAAGGACATGAAGGG - Intronic
1008602355 6:53108587-53108609 CTGAGGGCCAGCTGCATGAAGGG + Intergenic
1010744957 6:79550392-79550414 CTTAGGGAAAAATCCAGGAGTGG - Intergenic
1010806611 6:80244556-80244578 CTGAGGGAAAAATGGATAACAGG + Intronic
1011216130 6:85007794-85007816 CTGAGTGAAAAATCATTGAATGG + Intergenic
1011669034 6:89664503-89664525 TTGATGGGAAAATGCATGATGGG - Exonic
1012626561 6:101411085-101411107 CTTAGGGAAAGATGAAAGAATGG - Intronic
1012755543 6:103225863-103225885 CAAAAGGAAAAATGGATGAATGG + Intergenic
1014157801 6:118132239-118132261 GTGAGGGCAAAATATATGAAGGG + Intronic
1014503407 6:122222785-122222807 CTGATGGAAAAATGGAGCAAGGG - Intergenic
1015864924 6:137718241-137718263 TGGAGGGAAAAATGTATGCAAGG + Intergenic
1016030164 6:139328904-139328926 CTGAGGCAGAATTGCTTGAATGG + Intergenic
1017112203 6:150942503-150942525 CTAAGGAAAAAATGAATGTATGG + Intronic
1019244606 6:170700104-170700126 CTGTGGGAAACCTGCATGATGGG - Intergenic
1020877291 7:13713974-13713996 GTGAAGTAATAATGCATGAAAGG - Intergenic
1021056941 7:16060557-16060579 GTGATGGAGAATTGCATGAAAGG + Intergenic
1021440898 7:20674445-20674467 CTCAGAAAAAAATGCAAGAAAGG - Intronic
1022408907 7:30121049-30121071 CTGTGGGAAAAATGTAACAATGG + Intronic
1022484566 7:30768427-30768449 AAGAGGGAAAAAAGCATGGAGGG - Intronic
1022884590 7:34629552-34629574 ATTAGAGAAAAATGTATGAAAGG + Intergenic
1022973976 7:35540299-35540321 CTGAGGGAAGAATCCAAGACAGG + Intergenic
1022976277 7:35559229-35559251 GTGAGGGAAAAATGAAGGGAAGG + Intergenic
1024143893 7:46491505-46491527 CTGTGGTAAAAATCCAGGAAAGG + Intergenic
1024969598 7:55056130-55056152 GTGAGGGAAGATTGAATGAAAGG + Intronic
1028225237 7:88243476-88243498 ATGAGTGAAAAATGCAAGAAAGG - Intergenic
1028460737 7:91089295-91089317 CTCAGGGAAAACGGCATGATAGG + Intronic
1028618278 7:92795162-92795184 CTGAGGAAAGAAAGCATGAGGGG - Intronic
1030748077 7:113193211-113193233 CTGAAGGATAAATGCTTGAGGGG - Intergenic
1031702045 7:124938297-124938319 CTAAGGGAAAAATGAATGACTGG + Intergenic
1031888482 7:127265822-127265844 TTGATGGAAAAATGAATGGATGG + Intergenic
1033876677 7:145827866-145827888 CTAAGAGAAAAATACATGTAGGG + Intergenic
1034672801 7:152870797-152870819 CTGATGGAGAAAGGAATGAATGG + Intergenic
1034742868 7:153494974-153494996 CTGAGGGAAAAATGGTTTCATGG + Intergenic
1034916785 7:155046710-155046732 CTCAGCTAAGAATGCATGAAGGG + Intergenic
1035503520 8:108072-108094 CTGTGGGAAACCTGCATGATGGG + Intergenic
1036147904 8:6271724-6271746 CTGAGGGAAAAATGAATGAGGGG - Intergenic
1036496621 8:9276044-9276066 GTGAGGGAAAAAGGAAGGAAGGG - Intergenic
1036595830 8:10211212-10211234 CAGTGTGAAAAATGCATGAATGG + Intronic
1037119235 8:15263335-15263357 CAGAGGGAGGAATGGATGAAGGG + Intergenic
1037369852 8:18164067-18164089 CATAGTGAAAAATGCATGAAAGG + Intergenic
1037635808 8:20700367-20700389 CTGAGGAAAAGATGAAAGAAGGG + Intergenic
1038037275 8:23696941-23696963 CTGAGTGAAAAATGCATGAGAGG - Intergenic
1039628896 8:39087014-39087036 CTGATGGATATATGCATGTAAGG - Intronic
1040567321 8:48579407-48579429 CTGTGAGAACATTGCATGAATGG + Intergenic
1040751524 8:50714591-50714613 CTGAGAAAAAAATACATGCATGG + Intronic
1041108164 8:54460971-54460993 CTTAGGGGAGAATCCATGAATGG + Intergenic
1042274479 8:66988988-66989010 CAAAGGGAAAAATGGAAGAAAGG + Intronic
1043381480 8:79706828-79706850 ATGAGGGAAAAATGCATACTTGG - Intergenic
1044103439 8:88170838-88170860 CTGATGGAAAAATGGATGATGGG + Intronic
1045566329 8:103319726-103319748 CTGAAGGAAAAAAGCATTCAAGG + Intronic
1045707136 8:104937371-104937393 CTGACTGAGAAATGCATCAAGGG - Intronic
1045906242 8:107348501-107348523 TTGGGGGAAAAATGAATGAAGGG - Intronic
1046378380 8:113418811-113418833 CAGAGGTAAAAATGTATCAATGG + Intronic
1046703787 8:117427799-117427821 CTCAGGGTTAAATGCATTAAGGG + Intergenic
1046790224 8:118313732-118313754 CTTAGGAAAAAATGCAATAATGG - Intronic
1047831996 8:128643529-128643551 TTGAGTGAAAAAAGCAGGAAAGG - Intergenic
1048537369 8:135309887-135309909 CTGATGGGAAAATACAGGAAAGG + Intergenic
1049156214 8:141068294-141068316 AGAAGGGAAAAAGGCATGAACGG + Intergenic
1050189641 9:3011158-3011180 CAGAGGGAAAGATGCATGAAAGG - Intergenic
1051071190 9:13169614-13169636 CTGAGGGAAGTATGCATTGAAGG - Intronic
1051406237 9:16740772-16740794 CAGAGGGAAAATGGTATGAAAGG + Intronic
1051428508 9:16959167-16959189 CTGGAGGAAAAGGGCATGAAGGG - Intergenic
1052024668 9:23561240-23561262 CTGGGGGAAGAAGGGATGAAGGG + Intergenic
1052046110 9:23795932-23795954 CCGGGGGAAAAATGCATAAGTGG + Intronic
1055283752 9:74705587-74705609 CAGAAGCAAAAATGGATGAATGG + Intergenic
1055408924 9:76006455-76006477 GTGAAGGAAAAAGGAATGAAGGG - Intronic
1056341554 9:85638196-85638218 CTGAGGGAAAGAGGAAAGAAAGG + Intronic
1057707594 9:97407805-97407827 GTGTGGACAAAATGCATGAAGGG + Intergenic
1058818395 9:108706513-108706535 ATGAATGAAAAATGCATGAGAGG + Intergenic
1060538789 9:124415255-124415277 CTGAGGGAAGAATTCATGGCGGG - Intronic
1061703101 9:132431060-132431082 GTGAGGGAAGAATCCAGGAAAGG + Intronic
1061784186 9:133015575-133015597 CACAGGCAAAAATTCATGAAGGG + Intergenic
1062710616 9:137973257-137973279 CTGAGGGAAAAATGGCTGGAGGG + Intronic
1203527614 Un_GL000213v1:104530-104552 ATGGGGGAAAAAAGAATGAAAGG - Intergenic
1203604796 Un_KI270748v1:49334-49356 CTGTGGGAAACCTGCATGATGGG - Intergenic
1186674866 X:11805564-11805586 CTGAGTGAAAAATGCCAAAATGG + Intergenic
1187480626 X:19651900-19651922 CTGAAGGAAAAGGGCAAGAAAGG - Intronic
1188206133 X:27360647-27360669 CTGGGGCAATAATGCAAGAATGG + Intergenic
1188399659 X:29729261-29729283 CAGAGGGAAAAATGGGTGACAGG - Intronic
1188572149 X:31600707-31600729 CTCAGGGAAAAAGAGATGAAGGG - Intronic
1189730494 X:44015220-44015242 CTGAGGCAAAATCCCATGAAGGG - Intergenic
1190810847 X:53881847-53881869 TTGAGAGAAAATTACATGAAGGG - Intergenic
1192361372 X:70442579-70442601 CAGATTGAAAAATGAATGAATGG + Intergenic
1192555297 X:72084406-72084428 CTAAGGGAAAGATGCAGGACTGG + Intergenic
1194085009 X:89515867-89515889 CTGTGTGGGAAATGCATGAAGGG - Intergenic
1195433557 X:104816633-104816655 GTGATGGAAAAATGTATGATAGG + Intronic
1196050807 X:111301910-111301932 ATTAGGGAAAATTGAATGAAGGG - Intronic
1196582583 X:117394215-117394237 ACGAGGGAAAAATGGATTAATGG - Intergenic
1197296734 X:124728497-124728519 CTAAGTGAAAAATGGAGGAAAGG - Intronic
1197526444 X:127570291-127570313 CAAAGAGAAAAATGCATGAGGGG + Intergenic
1198713392 X:139529837-139529859 CAGAGGGATAAATACATCAATGG + Intergenic
1199032857 X:143021452-143021474 ATGAAGGATAAATGCTTGAAGGG + Intergenic
1199192501 X:144987047-144987069 CTGTGAGAATGATGCATGAATGG - Intergenic
1199343387 X:146708886-146708908 GTGAGGGAAAAATACTGGAAAGG - Intergenic
1199841958 X:151658254-151658276 CTAAGGTGAAAATGCATGCATGG - Intronic
1199877169 X:151942792-151942814 TTGGGGGAAAAATTCATAAAAGG - Intergenic
1200437658 Y:3171752-3171774 CTGTGTGGGAAATGCATGAAGGG - Intergenic
1202017522 Y:20426369-20426391 CTGAGGGAAAAATGCACAATTGG - Intergenic