ID: 1064824937

View in Genome Browser
Species Human (GRCh38)
Location 10:19387740-19387762
Sequence CCTCCCAAAGACCACACACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064824937 Original CRISPR CCTCCCAAAGACCACACACT TGG Exonic
901939340 1:12650170-12650192 TCTCCCACAGACCTCACATTTGG - Intronic
902686898 1:18083564-18083586 CATGACAAAGACCACAGACTGGG + Intergenic
903708708 1:25306071-25306093 CATCCCAAAGACAACACAGCTGG - Intronic
903718402 1:25386347-25386369 CATCCCAAAGACAACACAGCTGG + Intronic
906344763 1:45008259-45008281 CCTGCCTGGGACCACACACTGGG - Exonic
907789667 1:57649763-57649785 CCTCCCATACACCAGGCACTGGG + Intronic
907927875 1:58971740-58971762 CCTCCCAAAGACTCCTGACTGGG - Intergenic
908793518 1:67807014-67807036 ACTAACAGAGACCACACACTGGG + Intronic
910501822 1:87900881-87900903 CCACCTCTAGACCACACACTAGG - Intergenic
911165456 1:94720623-94720645 CCTGGCAAAGGCCACACTCTTGG - Intergenic
913051986 1:115125465-115125487 CCTCCAAATGTCAACACACTGGG - Intergenic
913063844 1:115231893-115231915 CCTCCCTAAGAACACATTCTTGG + Intergenic
917433433 1:174995590-174995612 GGTCCCAAAGGCCAAACACTTGG + Intergenic
918046002 1:180941381-180941403 CCTCCCAAGGAGCCCACAGTAGG + Intronic
918282376 1:183020056-183020078 GCTGCCAAACACCACACACATGG + Intergenic
918875303 1:190033635-190033657 CCTCCCAATTACCATACATTAGG + Intergenic
919881602 1:201904638-201904660 CCTCCTCAAGAACAGACACTTGG - Intronic
920018372 1:202932502-202932524 GCTGCCAAAGAACATACACTGGG - Intergenic
921300833 1:213749995-213750017 CTTCCCAAAGATGAAACACTGGG + Intergenic
921931466 1:220757743-220757765 CCTCCCATAGGCCCCACATTGGG + Intronic
923058409 1:230447660-230447682 CCTCCCAAAGACGAAAAACCTGG - Intergenic
1064082253 10:12318195-12318217 CCTCCCAAACACCTCCTACTAGG - Intergenic
1064824937 10:19387740-19387762 CCTCCCAAAGACCACACACTTGG + Exonic
1065622242 10:27594171-27594193 CCTCCAAGAGAGCTCACACTTGG - Intergenic
1066193453 10:33076854-33076876 CCTCCCAAAAGCCACATACAGGG - Intergenic
1066612547 10:37265348-37265370 CATCCCAGAGACCCCACCCTGGG + Intronic
1067109427 10:43389710-43389732 CATCACCAAGACCAAACACTCGG + Intronic
1067523586 10:47025746-47025768 CTGTCCAAAGACCACAGACTTGG - Intergenic
1070655857 10:78270732-78270754 CCACCCACACAGCACACACTGGG - Intergenic
1072019956 10:91388829-91388851 CATGGCACAGACCACACACTTGG - Intergenic
1072709553 10:97707218-97707240 ACCCCCGAAGACCACACTCTGGG - Intergenic
1072945980 10:99810491-99810513 CCTTCCCAATCCCACACACTTGG - Intronic
1073080341 10:100855834-100855856 CATCCCAAACACCTCCCACTAGG - Intergenic
1073441679 10:103556060-103556082 TCCCCCACAGAGCACACACTTGG - Intronic
1074530051 10:114290901-114290923 CCTCCCAACGATCACTCTCTAGG - Intronic
1075242702 10:120792945-120792967 CCTCCCACAACACACACACTGGG + Intergenic
1075298486 10:121299264-121299286 CATCTGAAAGACCACACCCTTGG - Intergenic
1075695287 10:124430020-124430042 CAGCCCATAGACCACACATTGGG - Intergenic
1076249224 10:128972066-128972088 CCTCCCAGACAACACACACAAGG - Intergenic
1076309436 10:129493695-129493717 CCTCCCCCAGATCCCACACTGGG - Intronic
1076705430 10:132298679-132298701 CCTCCCAGTGACCCCACACACGG - Intronic
1077759710 11:5079940-5079962 CCTAGCATAGACCACACATTAGG + Intergenic
1077993100 11:7429635-7429657 ACTCCCAAAGAACACCAACTGGG - Intronic
1078725730 11:13929433-13929455 CCACCCAAAGACCAGACAGATGG - Intergenic
1079350326 11:19686439-19686461 CCACCCTGAGACCACACAATGGG - Intronic
1079469665 11:20766189-20766211 CCTGTCAAAGCCCAAACACTGGG + Intronic
1080005011 11:27397446-27397468 CCTTACAAAGACAAGACACTTGG + Intronic
1080297980 11:30752198-30752220 CTTCCCATGGACCAAACACTAGG + Intergenic
1081105003 11:39056004-39056026 CCTTCCAAAGAGCCCCCACTCGG + Intergenic
1083438872 11:62662896-62662918 CCTCCCAAAGACATCCCTCTAGG + Exonic
1083860472 11:65417613-65417635 CCTCCCCAAGCCCACCCACTGGG - Intergenic
1085048857 11:73369153-73369175 CCTTCCGACGTCCACACACTTGG + Intergenic
1085472440 11:76766909-76766931 CTTCCCAAAGGTCACACAGTTGG - Intergenic
1087147516 11:94826729-94826751 CCTCCCAATGTCACCACACTGGG + Intronic
1087867077 11:103242973-103242995 CCTCCCAAAGCCACCACACCGGG + Intronic
1089299822 11:117491959-117491981 CCTCCCCCAGACCACCCACCTGG - Intronic
1090602967 11:128391682-128391704 CCTTCCAGAGAACACACACTAGG + Intergenic
1091297694 11:134485511-134485533 GATCCCCAAGGCCACACACTAGG - Intergenic
1093228834 12:16517949-16517971 ACACCCAAGGACCAGACACTAGG + Intronic
1093601793 12:21035377-21035399 GGTGCCAAAGAACACACACTGGG - Intronic
1096069582 12:48767569-48767591 CCTCCCCAACACCAGAGACTTGG + Exonic
1096995881 12:55837909-55837931 CCTCCCAAAGGGCAGACACTCGG + Exonic
1099585077 12:84505208-84505230 CCTCAAAGAGACCACACACAGGG - Intergenic
1100682935 12:96948759-96948781 CCTAGAAAAGACTACACACTAGG - Intronic
1103187635 12:118974376-118974398 ACGCACAAAGACCACACATTGGG - Intergenic
1103351085 12:120283989-120284011 CATGCCAAAGACTACACAGTTGG - Intergenic
1103884309 12:124189305-124189327 CCTGCACAAGACCACACACCTGG - Intronic
1104270126 12:127275987-127276009 CCTCCCAAAACCCTCAGACTAGG - Intergenic
1105023989 12:132836655-132836677 CCTCACACAGAGCAGACACTTGG - Intronic
1106126919 13:26908202-26908224 CCTTCTAAAGGCCACACACATGG - Intergenic
1106807042 13:33320319-33320341 CTTCCCAGAGACCACACTCCAGG + Intronic
1107731376 13:43352426-43352448 CCTCCCACAGTCCAAACACAGGG + Intronic
1107802833 13:44126471-44126493 CCTTCTAAACACCACGCACTGGG + Intergenic
1109412619 13:61993160-61993182 CCTCCCAGAGAGCAAACAATGGG + Intergenic
1111148990 13:84223330-84223352 CCTCCCACTGACCATTCACTTGG + Intergenic
1111482469 13:88848938-88848960 CCACCCAAACACCTCTCACTAGG + Intergenic
1113812233 13:113149827-113149849 CCTCCCCAAGACCCCCCACTTGG + Intergenic
1119168035 14:72512244-72512266 CCTCACAATGACCAAACTCTGGG - Intronic
1121787037 14:96669761-96669783 CCACCCAAAGACCACATATATGG - Intergenic
1122344674 14:101051169-101051191 CATGACAAAGACCACACAGTTGG + Intergenic
1123494689 15:20814259-20814281 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1123551184 15:21383352-21383374 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1125685297 15:41559920-41559942 CCTCCCAAAGACCAGCAACCTGG - Intronic
1126918011 15:53487411-53487433 CCCTCCCAAGACCAGACACTTGG + Intergenic
1127583488 15:60359400-60359422 CCTCCAAAGGTCCACAGACTCGG + Intronic
1128894243 15:71357934-71357956 CCTACCAAATACCTCAAACTTGG + Intronic
1129237486 15:74232501-74232523 TCTCCCAGAGCCCCCACACTTGG + Intergenic
1130893296 15:88151274-88151296 CCTCTCACAGACCAGACTCTGGG + Intronic
1131966382 15:97848372-97848394 CCACAAAAAGTCCACACACTTGG - Intergenic
1132223482 15:100123081-100123103 TTTCCCAAGGACCCCACACTGGG + Intronic
1202959526 15_KI270727v1_random:110595-110617 CCTCCCAGAGACCAGGAACTTGG + Intergenic
1132484822 16:185387-185409 CCTCCCAAATAACCCACACCAGG - Intergenic
1133542725 16:6772131-6772153 CCACCAACAGACCACAAACTTGG - Intronic
1135359054 16:21795889-21795911 CTTCCCAAGCCCCACACACTGGG + Intergenic
1135457606 16:22612326-22612348 CTTCCCAAGCCCCACACACTGGG + Intergenic
1135615800 16:23909939-23909961 CCTCCTAAAAGCAACACACTGGG + Intronic
1136058898 16:27711200-27711222 CCCCCAAAAGACCACACCCGTGG - Intronic
1138179549 16:54932501-54932523 TCTCCCTACGACCACACACCCGG + Exonic
1138416151 16:56872527-56872549 CCTCCCAGTGTCCACACAATGGG - Intronic
1139971995 16:70782058-70782080 CCTCCCATTGACCATACACGTGG + Intronic
1141139141 16:81486061-81486083 GCTCCCAAAGGCCACACGCAAGG + Intronic
1141565024 16:84895654-84895676 CCTCACAAAGCCCACACTCTAGG - Intronic
1141756026 16:85991576-85991598 CCTCCCGAAGACCGCAGACACGG - Intergenic
1142374195 16:89698340-89698362 CCTCCCATAGGCCAGACCCTAGG + Intronic
1142626941 17:1198184-1198206 CCTCCCAGAGGCCACACATGAGG + Intronic
1143199293 17:5100893-5100915 CCTCCCCAAGGGCAGACACTAGG + Intergenic
1144114814 17:12077749-12077771 CCTGCAAAATACCACATACTAGG + Intronic
1146922537 17:36722975-36722997 CCTGCCACAGCCCACACACAGGG - Intergenic
1147515795 17:41116325-41116347 CCTCCCAAACACCCCACCCCAGG - Intergenic
1147581915 17:41631852-41631874 CCTCCCCAAGACCCCACTCGAGG + Intergenic
1149419702 17:56497502-56497524 CCTCCCAACAAACACACAGTAGG - Intronic
1151075631 17:71269146-71269168 ACTCCCATAGACCCCACACCAGG + Intergenic
1151156558 17:72127770-72127792 CCTGGCAAAGGCCACATACTGGG - Intergenic
1151174281 17:72274366-72274388 CCACACAAAGGACACACACTCGG - Intergenic
1151342553 17:73481211-73481233 CCTCCCAGAGGACAGACACTGGG + Intronic
1156479900 18:37429837-37429859 CCTACGGAAGACCCCACACTTGG + Intronic
1157300230 18:46473877-46473899 CCTCCCAAAGTCCCCACTCCCGG - Intergenic
1161019233 19:2000197-2000219 AGTCCCAATGCCCACACACTGGG - Intronic
1161550218 19:4908774-4908796 CCTCCCTGAGACCACCAACTGGG + Intronic
1162059155 19:8084369-8084391 ACTCACAAAGAACACACACTGGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162552050 19:11363512-11363534 TATCCCACAGACCCCACACTAGG - Intronic
1164770776 19:30807197-30807219 CCTCCCAAAGACATCTCACCAGG + Intergenic
1166017532 19:39994133-39994155 CCTCACACAGAGTACACACTGGG + Intronic
1166218709 19:41352482-41352504 CCTCTCCAAGACCAGACACCTGG + Intronic
1166253881 19:41588947-41588969 CCTCCCAGAGACCACACCCTGGG - Intronic
1166409670 19:42548096-42548118 CCTCCCAGAGACCACACCCTGGG + Intronic
1166680084 19:44760693-44760715 ACTCCCAAGCACCACGCACTCGG - Intergenic
1167092426 19:47353692-47353714 GCTCTCAAAGCCCACACGCTTGG - Exonic
1167385387 19:49160043-49160065 GCTCCCAAAGACGAGCCACTGGG + Intronic
1167516109 19:49924127-49924149 CCTCCCAGAGACTACACCATGGG + Intronic
1168169046 19:54574305-54574327 CCTCCCCAAGCCCACCCTCTGGG + Exonic
1168171821 19:54594669-54594691 CCTCCCCAAGCCCACACTCTGGG + Exonic
1168176547 19:54631504-54631526 CCTCCCCAAGCCCACCCTCTGGG + Exonic
926097197 2:10089341-10089363 CCTCCTAATGCCAACACACTGGG - Intergenic
926270872 2:11365109-11365131 CCTCCCAAAGAACATGAACTTGG + Intergenic
926756804 2:16243085-16243107 CCTTCCACAGACCACACACAGGG + Intergenic
926977197 2:18526759-18526781 CCTCCCAGAAACCTCACCCTGGG - Intergenic
928087822 2:28356730-28356752 TCTCCCAGAGACCACCCACGTGG + Intergenic
928238791 2:29568891-29568913 CCTCCTACAGACCATACACAAGG - Intronic
928430896 2:31217615-31217637 CCTTCCAGAGAACACACAGTGGG - Intronic
928946785 2:36778872-36778894 CCTCCTAAAGACTACACCCCAGG + Intronic
930289080 2:49470777-49470799 CCACACCAAGACCACACATTAGG + Intergenic
934937452 2:98475750-98475772 CCTCCCAAAGCCCCCACCCCAGG - Intronic
935432070 2:102986997-102987019 CCTCCCAGAGCCCACCCACAGGG - Intergenic
937282038 2:120724498-120724520 ACACCCAAACACCTCACACTAGG + Intergenic
938581006 2:132646377-132646399 CCTCCCACAGCCCAGAGACTAGG + Exonic
942076419 2:172360519-172360541 CCAGCCAATGACCCCACACTAGG - Intergenic
942840949 2:180360096-180360118 CCACCCAGATACCACACACTTGG + Intergenic
943401479 2:187416644-187416666 CATACCACAGACCATACACTTGG - Intronic
946302099 2:218830313-218830335 ATTCCCCAAGACCACACCCTTGG - Exonic
946534461 2:220610782-220610804 CCTCCCAAATAGCAAACACTTGG - Intergenic
946963110 2:225005949-225005971 ACTGCCAAAGACCACCCTCTAGG + Intronic
947783456 2:232792249-232792271 CCACCCAAAGCCCCCAAACTAGG + Intronic
948512498 2:238478195-238478217 CATCCCAAAGACGTCAAACTTGG - Intergenic
1170489860 20:16862001-16862023 CCTCCCAGTGACCACAAATTTGG + Intergenic
1172600580 20:36179976-36179998 CTGACCAAACACCACACACTCGG - Intronic
1173845870 20:46188197-46188219 CTTACCCAAGACCAAACACTGGG - Intronic
1174830393 20:53807013-53807035 CCTGCCCAAGACCACAGAGTTGG + Intergenic
1175976417 20:62712617-62712639 CCTCCCAAAGGCCCCAGACCTGG + Intronic
1180996041 22:19965803-19965825 CCTCCCAATGCCCACCCCCTTGG - Intronic
1182271814 22:29158549-29158571 CCTCACAAAGGCCCCACATTTGG + Intronic
1183241995 22:36664562-36664584 CCTGTCCAAGACCTCACACTGGG + Intronic
953120060 3:40031294-40031316 CCTCCTAAAAACATCACACTGGG + Intronic
954075802 3:48179143-48179165 CCTCCCCAAGTGCACACTCTGGG + Intronic
957758379 3:84522604-84522626 CCTCCCAATGTCCAGCCACTTGG - Intergenic
960717509 3:120591964-120591986 CCTCCAAAAGAAGACATACTGGG - Intergenic
963031907 3:140987184-140987206 CTTCCCAAACACCTCTCACTAGG - Intergenic
963150049 3:142035968-142035990 CTTCTCAAAGTCCACATACTTGG + Intronic
964423219 3:156526579-156526601 GCTGCCAAAGGCTACACACTGGG + Intronic
965108189 3:164386269-164386291 CAACCCAAAGACCTCCCACTAGG - Intergenic
967484163 3:190010701-190010723 CATCACAAAAACCACAGACTGGG - Intronic
968487182 4:868265-868287 CCTCCCCAGGCCCACAGACTGGG + Intronic
969391251 4:6892655-6892677 CCTGCCGAAGGCCACACAGTGGG - Intergenic
972832054 4:42825717-42825739 TTTGCCCAAGACCACACACTTGG + Intergenic
974610296 4:64207838-64207860 TATCCAAAATACCACACACTGGG - Intergenic
974736619 4:65943237-65943259 CCTAGCAAATACCAGACACTAGG - Intergenic
976530128 4:86142151-86142173 CATCCCAACAACCACACACCAGG + Intronic
977544273 4:98358402-98358424 CCACCAAAAAACAACACACTCGG - Intronic
978944843 4:114482722-114482744 CTTACCAGACACCACACACTAGG - Intergenic
981107673 4:140899621-140899643 CTTCCCAAGGAGCACACACCAGG - Intronic
983621805 4:169769752-169769774 CCTCCCAACGCCATCACACTGGG - Intergenic
986570067 5:9155233-9155255 CATCCCAAAGAGCAAGCACTAGG - Intronic
986640950 5:9871556-9871578 CCTCCCCAACTGCACACACTCGG + Intergenic
988889144 5:35595820-35595842 CTTCCCACACACCACCCACTTGG - Intergenic
990730180 5:58800099-58800121 ACTTCCAAACACCACTCACTGGG - Intronic
992178501 5:74174022-74174044 CCTCTCAAAGACCACAAACGTGG - Intergenic
994102284 5:95907175-95907197 CCTCTCTAAGAACACACTCTTGG + Intronic
996502549 5:124232786-124232808 CTTCCCCAAGACTACTCACTGGG - Intergenic
998663346 5:144266082-144266104 CCTCTCAGAGGCAACACACTGGG - Intronic
1000336327 5:160244194-160244216 CCTGCCTAAGTCCACACAGTTGG + Intergenic
1002421193 5:179149964-179149986 CCTCACAGAGACCACCCACCTGG - Intronic
1002874352 6:1198426-1198448 CTTGACAAAGACCACACACCTGG - Intergenic
1003082784 6:3035448-3035470 CGTCCCAAACACCTCCCACTAGG - Intergenic
1003159730 6:3624770-3624792 CCTACAAAATACCACAGACTGGG + Intergenic
1003184523 6:3819553-3819575 CCATCCCAAGACCACGCACTAGG - Intergenic
1003545960 6:7058629-7058651 ACTGCCAAATACCACACCCTGGG - Intergenic
1006163864 6:32053346-32053368 CCTCCCACAGGCCCCACTCTGGG + Intronic
1008142014 6:47842899-47842921 CCTCTGAAAGTCCACACCCTTGG + Intergenic
1008694291 6:54015988-54016010 CCTACCAAATACTACAGACTGGG + Intronic
1012217866 6:96610550-96610572 CCTGCCAAAGACCACAGAAAAGG - Exonic
1013069849 6:106718867-106718889 CCTCCCGCAAAGCACACACTTGG - Intergenic
1015883503 6:137892896-137892918 CCTCCCATATACCACACGGTGGG + Intergenic
1018008460 6:159645907-159645929 CCTGCCAAAGACCACAGAGGAGG + Intergenic
1019892814 7:3960253-3960275 ACTTCCACAGGCCACACACTGGG - Intronic
1022047264 7:26631817-26631839 CCTCCCAAAGACCATGAAATTGG - Intergenic
1022470800 7:30681032-30681054 CCTCCCGCAGACCACACACCTGG + Intronic
1023295952 7:38715339-38715361 TCACCCAAACACCTCACACTAGG + Intergenic
1023807187 7:43881221-43881243 CCTGCCAAGGGCCACACACTGGG - Intronic
1028010488 7:85636763-85636785 CCTCCCAAAAACCAACCACTTGG + Intergenic
1029094449 7:98073898-98073920 CATCCCAAAGTCCACACACCCGG - Intergenic
1029687108 7:102156574-102156596 CCTCCCAATGCCCCCACACTGGG + Intronic
1031337880 7:120559299-120559321 CCTGGCAAATACAACACACTCGG - Intronic
1037631414 8:20660119-20660141 CTTCTTAAACACCACACACTCGG + Intergenic
1039887979 8:41666083-41666105 CCTTCCCAAGACCCCACAGTAGG - Intronic
1040631607 8:49219652-49219674 CCTGCCCAAGCTCACACACTCGG - Intergenic
1040832811 8:51696469-51696491 CATAACAAAGACCACAGACTTGG - Intronic
1041148686 8:54908421-54908443 CCTCTCAAAGACCACTCCCATGG + Intergenic
1041456464 8:58066300-58066322 CCTCCCTGAGAACTCACACTCGG + Intronic
1043210177 8:77504282-77504304 CATCCCAAACACCTCCCACTGGG + Intergenic
1043546088 8:81317235-81317257 CTGCCAAAAGACCACACACTGGG - Intergenic
1044817042 8:96124121-96124143 TCTGCCGAGGACCACACACTGGG + Intergenic
1044865420 8:96565992-96566014 CCTCCCCAAGATCACACAGCTGG - Intronic
1045249200 8:100469005-100469027 CTCCACAAAGACCATACACTGGG - Intergenic
1047194355 8:122708019-122708041 CCTCCCAAAGGCCCCACTTTGGG + Intergenic
1047761951 8:127961052-127961074 CCACCCTAAGTCCACACCCTGGG - Intergenic
1047925672 8:129680223-129680245 CCTCCCAGACACCAAGCACTAGG + Intergenic
1048098952 8:131326148-131326170 CTTCCCAAAGGCCACACCTTTGG - Intergenic
1048226518 8:132592458-132592480 CCTTCTAAAGCCCATACACTAGG - Intronic
1049204242 8:141355989-141356011 CATCCCAAAGCCCCCACTCTAGG - Intergenic
1049480913 8:142822161-142822183 GCAACCAAAGACCTCACACTGGG - Intergenic
1049579684 8:143405619-143405641 CCTCCCGAGGACCCCTCACTGGG + Intergenic
1050976812 9:11949469-11949491 CCCCCAACAGAGCACACACTGGG - Intergenic
1053446883 9:38159414-38159436 CCTCCCAAGGGCCACACTCCAGG - Intergenic
1054802848 9:69368974-69368996 CCTCCCCAGGACCCCACCCTCGG + Intronic
1056065260 9:82926884-82926906 CCTTCCCAAGAAAACACACTGGG - Intergenic
1056116813 9:83448654-83448676 CCTCCCTAAGACCACAGAGCGGG + Intronic
1056737905 9:89225483-89225505 ACCCCCAAAGGCCACACAATGGG + Intergenic
1056986613 9:91369392-91369414 CATAACAAATACCACACACTGGG + Intergenic
1057506809 9:95640904-95640926 CCTCCCAAAGAGTGCTCACTGGG + Intergenic
1061046655 9:128168961-128168983 CCTCCCGGAGGCCAGACACTGGG - Intronic
1062501378 9:136853425-136853447 CCTCACTCAGACCACACACTGGG + Exonic
1186321601 X:8432549-8432571 CCTCCCAAAGACCTCCTACATGG + Intergenic
1186392074 X:9170866-9170888 CCCCCTAAAAACCAAACACTGGG - Intergenic
1187864363 X:23710470-23710492 CCGCCCAAAGAAGGCACACTTGG + Intronic
1187925692 X:24248193-24248215 CCTCCCAAAGACAACAGTTTCGG + Intergenic
1188279588 X:28248495-28248517 CTTGCCCAAGATCACACACTTGG + Intergenic
1189388833 X:40558913-40558935 CTTCCCTAAGAGCAAACACTGGG - Intergenic
1189486998 X:41442128-41442150 CCTGCCAAAGGTCACACCCTGGG - Intergenic
1189897144 X:45667522-45667544 CCTCCCAATGCCCACTCACGGGG - Intergenic
1191993632 X:67066331-67066353 CATCACAAAGATCACCCACTGGG - Intergenic
1193514260 X:82444866-82444888 CCTCACAAAGTGCACAAACTGGG + Intergenic
1194132563 X:90099899-90099921 CCTCCCAAAGATGCCACACCAGG + Intergenic
1196376086 X:115034069-115034091 TCTGCCAAAGACCTCTCACTAGG - Intergenic
1197978309 X:132188951-132188973 CCTCCCAAATATCATATACTTGG + Intergenic
1198861584 X:141076577-141076599 CTTCCAGAATACCACACACTTGG + Intergenic
1198901107 X:141510806-141510828 CTTCCAGAATACCACACACTTGG - Intergenic
1200478354 Y:3669978-3670000 CCTCCCAAAGATGCCACACCAGG + Intergenic