ID: 1064825879

View in Genome Browser
Species Human (GRCh38)
Location 10:19400127-19400149
Sequence GGAGCTTGTGAGTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064825876_1064825879 1 Left 1064825876 10:19400103-19400125 CCTTAATACACTGTCTACTATCA 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1064825879 10:19400127-19400149 GGAGCTTGTGAGTTTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064825879 Original CRISPR GGAGCTTGTGAGTTTAAAGT GGG Intronic
No off target data available for this crispr