ID: 1064833072

View in Genome Browser
Species Human (GRCh38)
Location 10:19493191-19493213
Sequence TTATAGAGATGGAGAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1082
Summary {0: 1, 1: 0, 2: 9, 3: 128, 4: 944}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064833072_1064833075 1 Left 1064833072 10:19493191-19493213 CCTTCTCCTCTCCATCTCTATAA 0: 1
1: 0
2: 9
3: 128
4: 944
Right 1064833075 10:19493215-19493237 AGATCTTTCATTTCTATTCTAGG No data
1064833072_1064833076 17 Left 1064833072 10:19493191-19493213 CCTTCTCCTCTCCATCTCTATAA 0: 1
1: 0
2: 9
3: 128
4: 944
Right 1064833076 10:19493231-19493253 TTCTAGGTACCTCATATCAGTGG 0: 1
1: 66
2: 316
3: 925
4: 1693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064833072 Original CRISPR TTATAGAGATGGAGAGGAGA AGG (reversed) Intronic
900037370 1:427429-427451 TCATGGAGATAGAGAGTAGAAGG + Intergenic
900059000 1:663170-663192 TCATGGAGATAGAGAGTAGAAGG + Intergenic
901343477 1:8516932-8516954 TGTTAGAGATGGTGGGGAGAGGG + Intronic
902136583 1:14311478-14311500 CTATAGAGATTTAGAGAAGATGG + Intergenic
902144802 1:14389662-14389684 TCATGGAGATAGAGAGTAGAAGG + Intergenic
902729078 1:18356986-18357008 GAATGGAGATGGAGTGGAGATGG + Intronic
902779670 1:18696709-18696731 TCATGGAGATAGAGAGTAGAAGG + Intronic
903478305 1:23635446-23635468 TGAGAGAGTTGGAGAGGGGAAGG + Intronic
903481864 1:23659479-23659501 TTGTAGATATGGGCAGGAGAGGG - Intergenic
903780423 1:25816906-25816928 TTAAAAAGCTGAAGAGGAGAAGG - Exonic
904309788 1:29621301-29621323 TGAGAAAGATGGAGAGGAAAAGG - Intergenic
904476260 1:30766479-30766501 TGATGGAGAGGGAGGGGAGACGG - Intergenic
904602276 1:31680181-31680203 CTCTAGAGATGGAGAGGCCAGGG + Intronic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905288032 1:36898084-36898106 TCATGGAGATAGAGAGTAGAAGG + Intronic
905807139 1:40885080-40885102 TTGTAGAGATGGAGTGGTGGGGG - Intergenic
906184669 1:43852245-43852267 TTAGAGAGATGGGGAGGGGATGG + Intronic
906246614 1:44280114-44280136 TTATAGAAATGGGCATGAGAAGG - Intronic
906301014 1:44681640-44681662 GGCTAGAGAAGGAGAGGAGAAGG + Intronic
906343094 1:44997981-44998003 CCATAGAGATAGAGAGTAGAAGG + Intergenic
906426557 1:45718807-45718829 TCATGGAGATAGAGAGTAGAAGG + Intronic
906826737 1:48989554-48989576 TCATGGAGATAGAGAGTAGAAGG - Intronic
907110407 1:51921799-51921821 TTAGAAAGATGGAGAGGAGGTGG - Intronic
907467687 1:54650209-54650231 TCTTAGAGATGGGGAGGACAAGG + Intronic
907739845 1:57154218-57154240 TCATAGAGCTGGAGAGTAAAAGG - Intronic
907975836 1:59430658-59430680 TAATAAACATGGAAAGGAGATGG + Intronic
909208828 1:72796139-72796161 TCATGGAGATAGAGAGTAGAAGG - Intergenic
909543648 1:76818900-76818922 CTATTAAGATGGAGAGGAGGAGG - Intergenic
909773434 1:79455508-79455530 TAATACAAATAGAGAGGAGAAGG - Intergenic
910135687 1:83966387-83966409 TTATATATATGGAGAGGGGTTGG - Intronic
910290169 1:85592841-85592863 TCATGGAGATAGAGAGTAGAAGG + Intergenic
910404166 1:86868549-86868571 TCAGAGAGAGGGAGAGGGGAAGG + Intronic
911001041 1:93165943-93165965 TTATGGAGATAGAGAGTAGAAGG - Intronic
911283587 1:95961302-95961324 TCATGGAGATAGAGAGTAGAAGG - Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912017906 1:105065166-105065188 TATTAGAGATGTTGAGGAGAGGG + Intergenic
912140973 1:106726842-106726864 TCATGGACATGGAGAGTAGAAGG + Intergenic
912606530 1:110995594-110995616 TTATGGAGATAGAGAGTAGAAGG - Intergenic
912749818 1:112277493-112277515 TCATGGAGATAGAGAGTAGAAGG + Intergenic
914140524 1:144943358-144943380 TTATTGAAATGTAAAGGAGAAGG + Intronic
914812528 1:151039284-151039306 TTATAAAGATGAATAAGAGAGGG + Intronic
915020179 1:152771765-152771787 TTAGAGAGATGGAGATGGTAGGG - Intronic
915337796 1:155157232-155157254 TCATGGAGATGGAGAATAGAAGG + Intergenic
915565157 1:156708840-156708862 GAATAGAGATGGGCAGGAGAGGG + Intergenic
915627785 1:157126366-157126388 ATTTAGAGTTGCAGAGGAGAAGG - Intronic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915985110 1:160456798-160456820 AGATAGAGATGGAGATGATAGGG - Intergenic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916146220 1:161742478-161742500 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916287033 1:163119183-163119205 TTATAGAATTAGAGAGTAGAAGG + Intronic
916334918 1:163660125-163660147 TCATGGAGATAGAGAGTAGAAGG - Intergenic
916401754 1:164457105-164457127 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916615867 1:166438673-166438695 TCATAGAGATAGAGAGTAGAAGG - Intergenic
916911619 1:169354348-169354370 TCATGGAGATAGAGAGTAGAAGG + Intronic
916979732 1:170120913-170120935 TCACAGAGATAGAGAGGAGAAGG - Intergenic
916993160 1:170266503-170266525 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917225908 1:172782064-172782086 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917258117 1:173138410-173138432 TCATGGAGATAGAGAGTAGAAGG + Intergenic
917271179 1:173276348-173276370 TGGTAGAGGTGGAGAGGAGAAGG - Intergenic
917416271 1:174813249-174813271 AGATAGAGATGGAGTGGAGATGG + Intronic
918102765 1:181390955-181390977 TTACAGAGATGGAAAGGTAAGGG - Intergenic
918672287 1:187233590-187233612 TCACAGAGATAGAGAGTAGAAGG - Intergenic
918959645 1:191256981-191257003 TTATAGAGACAGAAAGTAGAAGG + Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919316377 1:195975677-195975699 TCATGGAGATAGAGAGTAGAAGG - Intergenic
919429889 1:197479452-197479474 CAAAAGAGATGGAGAGGGGATGG - Intergenic
919622684 1:199880482-199880504 TTAAACAGTTGGAGAGGAGGAGG - Intergenic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
920246640 1:204592811-204592833 TGAAAGAGAAGGAAAGGAGAGGG - Intergenic
920484366 1:206355023-206355045 TTATTGAAATGTAAAGGAGAAGG - Intronic
920493990 1:206441132-206441154 TTATGGAGTTGGAGAAGACAAGG + Intronic
920594222 1:207252286-207252308 TCATGGAGATAGAGAGTAGAAGG - Intergenic
921032070 1:211342684-211342706 TTATGGAGACAGAGAGTAGAAGG - Intronic
921100254 1:211922655-211922677 TGATGGAGATTAAGAGGAGATGG - Intergenic
921236248 1:213134336-213134358 TAAAAGGGAAGGAGAGGAGAAGG - Intronic
921271214 1:213471843-213471865 TTATGGAGATGGTGAGGACAGGG + Intergenic
921273706 1:213495633-213495655 TTTTACAGATGGGGAGCAGAAGG + Intergenic
922502676 1:226108953-226108975 GTATAGAGATGGGGAGGGGATGG + Intergenic
923721961 1:236474539-236474561 TTATTGGTTTGGAGAGGAGAGGG - Intronic
923888172 1:238180876-238180898 TCATAGAGATGGAAAAGATAGGG - Intergenic
924481449 1:244439074-244439096 TCATGGAGATAGAGAGTAGAAGG - Intronic
924768594 1:247057795-247057817 TTATGGAGATAGAAAGTAGAAGG + Intronic
924806102 1:247363157-247363179 TGAGAGAGGGGGAGAGGAGAAGG - Intergenic
924806132 1:247363271-247363293 TGAGAGAGGGGGAGAGGAGAAGG - Intergenic
924888440 1:248246111-248246133 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1062764924 10:54218-54240 TCATAGAGATAGAGAGTATAAGG - Intergenic
1062769549 10:88031-88053 TTCTAGACAGGGAGAGGGGATGG + Intergenic
1063561969 10:7136844-7136866 TCAGAGATATGGAGAGAAGAAGG + Intergenic
1063561973 10:7136901-7136923 TCAGAGATATGGAGAGAAGAAGG + Intergenic
1063576799 10:7268976-7268998 TTATAGACATGGATAGTATATGG + Intronic
1063613475 10:7582799-7582821 TTATGGAGATAAAGAGTAGAAGG + Intronic
1063713769 10:8506895-8506917 TCATGGACATGGAGAGTAGAAGG - Intergenic
1064419193 10:15175929-15175951 TCATAGAGACAGAGAGTAGAAGG + Intergenic
1064521099 10:16202133-16202155 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1064563328 10:16614322-16614344 TCATGGAGATAGAGAGGAGAAGG + Intronic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065067498 10:21985547-21985569 ATATAGAGATGGAAAGCAGGTGG - Intronic
1065149842 10:22811592-22811614 TTATATAGATGAAGAGGATTGGG + Intergenic
1065197686 10:23282876-23282898 TTACGGAGATAGAGAGAAGACGG + Intronic
1065362904 10:24905929-24905951 TCATGGAGATAGAGAGTAGAAGG - Intronic
1065833657 10:29637917-29637939 TTATAGAAATGGAGAAGAGATGG + Intronic
1066218345 10:33310638-33310660 TGATAGAATTTGAGAGGAGATGG - Intronic
1066418691 10:35244572-35244594 TCATAGAGATAGAAAGTAGAAGG - Intergenic
1066645158 10:37599486-37599508 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1067392316 10:45875006-45875028 TTGAAGAGATGGTGAGGAAAAGG - Intergenic
1067402616 10:45991424-45991446 TTGAAGAGATGGTGAGGAAAAGG + Intronic
1068002647 10:51354115-51354137 TCATTGAGATAGAGAGGAGAAGG + Intronic
1070010262 10:72466736-72466758 TTATAGAAAAGGAGACCAGAAGG - Intronic
1070058794 10:72960929-72960951 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1070336792 10:75463152-75463174 TTTTAGAGTTGGTGAGGACAGGG + Intronic
1070848466 10:79543160-79543182 ATACAGAGCTGGTGAGGAGAAGG + Intergenic
1071170174 10:82855010-82855032 TTAGACAGATGGGCAGGAGAGGG + Intronic
1071232947 10:83610192-83610214 TAATTCAGATGGAGAAGAGATGG + Intergenic
1071249912 10:83807055-83807077 TTAACCAGATGGAGAAGAGATGG - Intergenic
1071672102 10:87618459-87618481 ATAGAGAGAGAGAGAGGAGAGGG - Intergenic
1071759887 10:88590949-88590971 TTATAAATATGTAGAAGAGAAGG - Intronic
1071845198 10:89514780-89514802 TTGTAGAGATGAAAAGGAGCGGG + Intronic
1071879402 10:89878723-89878745 TCATAGAGATAGAGAGTAGAAGG - Intergenic
1072138146 10:92566571-92566593 TCATGGAGATAGAGAGTAGAAGG + Intronic
1072440216 10:95447645-95447667 TAATAGAGATTGAGAAGAGAAGG - Intronic
1072518780 10:96212097-96212119 TTATAGGGAAGGAAAGGAAAAGG - Intronic
1072582760 10:96753926-96753948 CTATAGAGGTGCAGAGGGGATGG + Intergenic
1072763788 10:98080058-98080080 ATGTAGAGATGAATAGGAGAGGG + Intergenic
1072794348 10:98343039-98343061 TTATAGAGATGGAGCTGATGTGG - Intergenic
1073201542 10:101739831-101739853 TTCAAAAGAGGGAGAGGAGAGGG + Intergenic
1073847583 10:107576305-107576327 TTATAGACAGAGAGAGGGGAAGG + Intergenic
1075651720 10:124131798-124131820 TTATAAAAAGGGAGTGGAGAGGG - Intergenic
1076028586 10:127138860-127138882 TCAAAGACATGGAGACGAGAGGG - Intronic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076077358 10:127545075-127545097 ACTGAGAGATGGAGAGGAGAGGG - Intergenic
1076285613 10:129293258-129293280 TCATAGAAATAGAGAGTAGAAGG + Intergenic
1076377171 10:129998963-129998985 TTATGGAGATAGAGAGTAGAAGG + Intergenic
1076439090 10:130467306-130467328 GTATAGAGATGGAGAGGAAGGGG + Intergenic
1076964096 11:65352-65374 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1078004577 11:7522986-7523008 TTATAGTGTTGGAGTGGGGATGG + Intronic
1078037199 11:7819514-7819536 TAATTGAGATAGAGAGTAGAAGG + Intergenic
1078038834 11:7838071-7838093 TGATAGAAATGGAGATGATATGG - Intergenic
1078105461 11:8355522-8355544 TTTTGTAGATGGAGAGGACAGGG - Intergenic
1078304427 11:10169365-10169387 TCATAGAGAGAGAGAGAAGAAGG - Intronic
1078861260 11:15249362-15249384 TTTTAGAGAAGGAGAAGATAGGG + Intergenic
1079092014 11:17487480-17487502 TCATGGAGATAGAGAGTAGACGG - Intergenic
1079298407 11:19255398-19255420 TTATAGAGATGAAGAAGCGAAGG + Intergenic
1079533168 11:21479499-21479521 TAATAGAGATGAAAAGTAGAAGG + Intronic
1079743636 11:24097281-24097303 TTATACAGAGGCAGAGGAGAGGG + Intergenic
1079877230 11:25875108-25875130 TTATATTGATGGAGAGAAGGAGG - Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080097238 11:28423664-28423686 TGATGGAGATAGAGAGTAGAAGG + Intergenic
1080312030 11:30905711-30905733 TTAAGGAGATGGTGAGGAGTTGG - Intronic
1080598348 11:33797082-33797104 TCACAGAGATAGAGAGTAGAAGG + Intergenic
1081194187 11:40141195-40141217 TTATAATGATGGATAGGAAAGGG + Intronic
1081422663 11:42889764-42889786 GTATAGAGGGGGAGTGGAGATGG + Intergenic
1081561718 11:44223584-44223606 TTATAGAAATGGAGGACAGATGG + Intronic
1081817820 11:45961776-45961798 TTAGAGCGCTGGAGAGGACAAGG + Intronic
1082208371 11:49467102-49467124 CTATAGAGGGAGAGAGGAGAAGG + Intergenic
1082900969 11:58251632-58251654 TCACAGACATAGAGAGGAGAAGG - Intergenic
1082972559 11:59038927-59038949 TTATAGAGATGGTGGGGCGGGGG - Intronic
1082977022 11:59082817-59082839 TTATAGAGATGGTGGGGGGGTGG - Intergenic
1083533290 11:63445027-63445049 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1083562288 11:63682122-63682144 TTAGAGAGATTGAAAGGATACGG + Intronic
1083739945 11:64703680-64703702 TTATAGAGGTGGAAAGGAAAGGG - Intronic
1083790424 11:64981320-64981342 TAATGGAGATAGAGAGTAGAAGG - Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084335184 11:68453350-68453372 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1084865200 11:72050255-72050277 GTAGAGAGGTGGGGAGGAGAAGG - Intronic
1085326284 11:75609165-75609187 TTATAGGGCTGGAGAGTAGATGG + Intronic
1085901285 11:80702854-80702876 AGAGAGACATGGAGAGGAGAAGG + Intergenic
1086010591 11:82098585-82098607 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1086033527 11:82388791-82388813 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1086173426 11:83861681-83861703 TCATGGAGATTGAGAGTAGAAGG + Intronic
1086396441 11:86420879-86420901 TTAGAGAAAAGGAGAGGAAAGGG + Intronic
1086416776 11:86596810-86596832 TTACAGAAAAGGAGAGCAGAAGG - Intronic
1087218948 11:95524973-95524995 TTCTTTAGATGGAGAGGACAGGG + Intergenic
1087234659 11:95704789-95704811 TTATTCTAATGGAGAGGAGAGGG + Intergenic
1087720333 11:101657457-101657479 TCATGGAGATAGAGAGTAGAAGG - Intronic
1088131431 11:106496715-106496737 TTAGATAGATGGAGAGGATGTGG + Intergenic
1088290029 11:108225950-108225972 TTAGATGGATGGATAGGAGAAGG + Intronic
1088361498 11:108994676-108994698 TAATAGAGATAGAGAGTAGAAGG - Intergenic
1088925095 11:114294097-114294119 TCACAGAGATAGAGAGTAGAAGG + Intronic
1088960937 11:114663548-114663570 AGATAGAGATAGACAGGAGATGG - Intergenic
1089899379 11:121964929-121964951 TGACAGGGGTGGAGAGGAGATGG + Intergenic
1089937846 11:122384234-122384256 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1090060207 11:123458104-123458126 TGAGAGAGAGAGAGAGGAGAGGG + Intergenic
1090317785 11:125810995-125811017 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1090623637 11:128585758-128585780 TTTTAGAGATGAAGGGAAGAAGG + Intronic
1091715420 12:2773115-2773137 TCATGTAAATGGAGAGGAGAGGG - Intergenic
1091925782 12:4347359-4347381 TCATGGAGATAGAGAGTAGAAGG + Intronic
1092292199 12:7167876-7167898 TCTAAGAGATGGAGAAGAGATGG + Intergenic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092666716 12:10808656-10808678 TTCCAGAAATGGAGAGGAAAGGG + Intergenic
1093087971 12:14887706-14887728 TTCTGGAGATGGAGTGGGGATGG - Intronic
1093225475 12:16478351-16478373 TTCAAGAGAATGAGAGGAGAGGG - Intronic
1093620972 12:21288473-21288495 TCATGGAGATAGAGAGCAGAAGG + Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093761097 12:22912003-22912025 TTATAGAAGTGGAGAGAAAATGG + Intergenic
1094128196 12:27045648-27045670 TTTAAGAGAGGGAGAGGAGAAGG + Intronic
1094146404 12:27232968-27232990 TCATGGAGATAGAGAGTAGAGGG - Intergenic
1095668208 12:44827502-44827524 TCATGGAGATAGAGAGTAGAAGG - Intronic
1095680313 12:44967189-44967211 TCACAGAGATAGAGAGTAGAAGG + Intergenic
1095796271 12:46222298-46222320 GTCTAGAGGTGGAGTGGAGATGG - Intronic
1096040127 12:48508012-48508034 TTAGAGGGATGGGGAGGAGGTGG - Intronic
1096040759 12:48514302-48514324 TCATGGAGATAGAGAGTAGAAGG - Intronic
1096224355 12:49855924-49855946 TCATAGAGATATAGAGTAGAAGG - Intergenic
1096675773 12:53225005-53225027 TAAAGGAGATGGAGTGGAGAGGG - Intronic
1096742348 12:53703017-53703039 TGATAGGGATGGGGAGAAGAGGG + Intergenic
1096930562 12:55204110-55204132 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1096949476 12:55451341-55451363 TCATAGACATAGAGAGTAGAAGG - Intergenic
1097332379 12:58345473-58345495 TTGGAGAGTTGAAGAGGAGAAGG - Intergenic
1097587381 12:61530879-61530901 GGAAAGAGAGGGAGAGGAGAAGG - Intergenic
1097897974 12:64844699-64844721 TGATAGAGATAGACAGTAGAAGG - Intronic
1098380657 12:69865995-69866017 TTTTACAGATGGGGAGGATAAGG + Intronic
1099094788 12:78360623-78360645 TTATAGTGCTGGAGGAGAGAAGG - Intergenic
1099125338 12:78748608-78748630 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1099242602 12:80155797-80155819 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1099459731 12:82907456-82907478 TTTTTGAGATGGAGTTGAGAAGG - Intronic
1099674744 12:85744043-85744065 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1099763688 12:86954395-86954417 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1099832251 12:87858628-87858650 TCATAGAAATGGAGAGTATAAGG + Intergenic
1100225410 12:92551312-92551334 TTTTTCAGATGGAGAGAAGACGG + Intergenic
1100267149 12:92988432-92988454 TTGTAGAGATGGGAAGGGGAGGG + Intergenic
1100995882 12:100300676-100300698 TCATGGAGATGGAGAGTAGAAGG - Intronic
1101237475 12:102804144-102804166 TTTTATAGATGAAGAGGAAAAGG + Intergenic
1101575093 12:105990065-105990087 TTATTGAGATGGGGAAGAGAAGG - Intergenic
1101664301 12:106796365-106796387 TTTTAGAGATGGAGGGGGGTGGG - Intronic
1101744422 12:107527734-107527756 TTATGGAGAAGGAGAGATGAAGG - Intronic
1102176661 12:110880724-110880746 TTATAGTGATGGGGTGGTGATGG + Intronic
1102213062 12:111140971-111140993 TTCTGAAGATTGAGAGGAGATGG + Intronic
1102517889 12:113462675-113462697 TGAAAGAGAGGGAGAGGAAAGGG - Exonic
1102792023 12:115654742-115654764 CTAAAGAGATGGAGAGAATAAGG + Intergenic
1102979597 12:117230922-117230944 TCATGAAGATGGAGAGTAGAAGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103169764 12:118806667-118806689 TCATAGACATAGAGAGTAGAAGG - Intergenic
1103586970 12:121963310-121963332 TTAAAGAGATGAGGAGGACAAGG + Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1104080338 12:125424827-125424849 TTATAGCCAAGGAGAGGAGGAGG + Intronic
1105892726 13:24693363-24693385 TCATTGAGATGGAGAGGAAAAGG - Intronic
1106238185 13:27883704-27883726 TTAAAAAGAAGGAGAGGAGTTGG + Intergenic
1106524451 13:30527629-30527651 AAAAAGAGATGGAGAGGAGATGG + Intronic
1106868526 13:33994093-33994115 TTAGAGAGATGCAAAGAAGAGGG + Intergenic
1107524621 13:41218018-41218040 TTATAGAGAGACAGAGGAAATGG + Intronic
1107596112 13:41964678-41964700 TTATAGAGAGGGAGGGAAAAAGG + Intergenic
1107678028 13:42817123-42817145 TTAATGAGATTGAGAGGAAATGG + Intergenic
1107835602 13:44410307-44410329 TTATTGGGATAGGGAGGAGATGG - Intergenic
1108106228 13:47013699-47013721 TGAAGGAGATGGGGAGGAGAAGG + Intergenic
1108138488 13:47392274-47392296 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1108153121 13:47557267-47557289 AGAGAGAGAGGGAGAGGAGAGGG - Intergenic
1108483246 13:50897251-50897273 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1108566527 13:51704440-51704462 TTATAATCATGGAGAGGATACGG + Intronic
1109363166 13:61323326-61323348 TTATAGAGAAAGACAGCAGAAGG + Intergenic
1109801034 13:67379547-67379569 TTAGTGATATGGACAGGAGACGG + Intergenic
1109824861 13:67705485-67705507 TCATAGGGATAGAGAGTAGAAGG + Intergenic
1109885188 13:68532684-68532706 ATATAGAGATGTAGAGATGAAGG - Intergenic
1109906722 13:68852798-68852820 GTATAGAAATTGAGAGTAGAGGG - Intergenic
1109911459 13:68917387-68917409 TCATAGAGGTAGAGAGGAGGAGG - Intergenic
1110280307 13:73685296-73685318 TTATAGAGATGGAGAAAGGATGG - Intergenic
1110469379 13:75841824-75841846 TTATTGAGAGAGAGAGGAAATGG + Exonic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1110952762 13:81516498-81516520 TTAGGCAGATGGAGAGGAAAAGG - Intergenic
1111022307 13:82467814-82467836 TTATGGACATAGAGAGTAGAAGG - Intergenic
1111069786 13:83150445-83150467 TTATAGAGATGGGGTGGGGGGGG + Intergenic
1111426355 13:88089277-88089299 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1111443705 13:88316228-88316250 TTAAAGAGATGCAGTGGAGAGGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111706747 13:91759553-91759575 TCATGGAGATGGAGAGTAGAAGG - Intronic
1112003210 13:95231086-95231108 TCATAGAGCTGGAAAGCAGAAGG + Intronic
1112910415 13:104476092-104476114 TTATAGAGACGCAAATGAGAAGG - Intergenic
1112924950 13:104662486-104662508 TTAAAATAATGGAGAGGAGAGGG + Intergenic
1113033181 13:106017056-106017078 TATCAGAGATGGAGAGGAGGTGG - Intergenic
1113221579 13:108109977-108109999 TTATAGAGAAGGAGAAGCAAAGG - Intergenic
1113403840 13:110019982-110020004 TCATAGAGATGGAGGGTACAGGG - Intergenic
1113698654 13:112366522-112366544 TTAGAGAGGTGGAGGGAAGAAGG + Intergenic
1115042316 14:28946629-28946651 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1115053045 14:29088657-29088679 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1115135000 14:30097246-30097268 CTATATAGATAGAGAGTAGAAGG + Intronic
1115678471 14:35709036-35709058 TCATGGAGATAGAGAGTAGAAGG + Intronic
1115949292 14:38701718-38701740 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1116140190 14:40983441-40983463 TCATGGAGATGGAGAATAGATGG - Intergenic
1116264998 14:42676668-42676690 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1116344024 14:43766330-43766352 TTATAGAAGTGGAGAGTAGATGG - Intergenic
1116458378 14:45144352-45144374 TCATAGAGATAGAGAGTAGAAGG - Intronic
1116930100 14:50682216-50682238 TCATGGAGATAGAGAGGAGAAGG - Intergenic
1117125007 14:52613533-52613555 TCATGGAGATAGAGAGTAGAAGG - Intronic
1117161004 14:52989542-52989564 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1117311179 14:54524781-54524803 TTATAGGGAAGGAGCGGGGAGGG - Intronic
1117333614 14:54737806-54737828 TTAAATAGATGCAGAGGAAAGGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118130900 14:62962132-62962154 AGATGGAGATGGAGATGAGAAGG + Intronic
1118459524 14:65975941-65975963 ATACAGAGAAAGAGAGGAGAGGG + Intronic
1119343062 14:73897226-73897248 TTAAAGAGATGGGGAGTGGATGG + Intronic
1119564161 14:75614609-75614631 TTATAGGGATACAGAAGAGAAGG + Intronic
1119687002 14:76640909-76640931 TTATGGAGCAGGAGAGGAGAAGG - Intergenic
1119770506 14:77217899-77217921 TCATGGAGATAGAGAGTAGAAGG + Intronic
1119853991 14:77885812-77885834 TTAAAGAAATGGAGAGGATTAGG + Intronic
1120266067 14:82252241-82252263 TTAGACAGATAGAGAGGAAAAGG - Intergenic
1120613384 14:86671043-86671065 TCATAGAGATAGAGAGCAGAAGG - Intergenic
1120668656 14:87337877-87337899 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1121377297 14:93424671-93424693 TCATAGAGATAGAGAGTAGAAGG + Intronic
1121632606 14:95432124-95432146 TTTTAGGGAAGGAGAGGAAAAGG + Intronic
1121876689 14:97459208-97459230 TTAGAGAGAGAGAGAGAAGAGGG + Intergenic
1121991972 14:98567074-98567096 GGCTAGAGATGGAGGGGAGAGGG - Intergenic
1122579598 14:102763193-102763215 TTAAAGAGGTGGGGAGGAAAGGG + Intergenic
1123111440 14:105869175-105869197 TGCTAGAGATGGAGGGGAAAAGG - Intergenic
1123959439 15:25380543-25380565 TTAAAGAAAAGAAGAGGAGAGGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124259056 15:28170971-28170993 TTAAAAAGATGGTGAGGATATGG + Intronic
1124499310 15:30212718-30212740 TTATAGAGAGAGAGAAGAGCAGG + Intergenic
1124744269 15:32325944-32325966 TTATAGAGAGAGAGAAGAGCAGG - Intergenic
1125236684 15:37522845-37522867 TTATAGAGAAGGAGCAGAGTAGG + Intergenic
1125701244 15:41686343-41686365 TTATAGAGATGGGGGTGAGCTGG - Intronic
1125705251 15:41729273-41729295 TGATGGAGATGGGGAGGAGGAGG - Exonic
1126182196 15:45796573-45796595 TTATATAAGTGGATAGGAGAAGG - Intergenic
1126216712 15:46163876-46163898 TCATAGACATAGAGAGTAGAAGG + Intergenic
1126789028 15:52203812-52203834 TCATAAAGATGGAGAGTAGAAGG - Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127164207 15:56227115-56227137 TTACAGAGGTGAAGAGGAAATGG - Intronic
1127390471 15:58501147-58501169 TTGTAGAGACGCAGAGGAAAGGG - Intronic
1127406324 15:58651437-58651459 TCATGGAGATAGAGAGTAGAAGG - Intronic
1128525631 15:68410443-68410465 TCACAGAGAGGGAGAGGAGGAGG + Intronic
1128681830 15:69658009-69658031 TAATGGAGAGGGAGAAGAGATGG - Intergenic
1129545951 15:76395030-76395052 TCATGGAGATGGAGAGTAGAAGG - Intronic
1129623246 15:77169099-77169121 TTTTAGAGATGGTGAGAAGGGGG + Intronic
1130440596 15:83949187-83949209 TCATGGAGATAGAGAGTAGAAGG - Intronic
1131245599 15:90789495-90789517 TTCTAGTGATGGAGAGCAGGTGG - Intronic
1131314662 15:91323968-91323990 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1132271337 15:100528687-100528709 TAACAGAGAGGGAGAGGAGATGG - Intronic
1132444455 15:101899831-101899853 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1132458683 16:38577-38599 TTCTAGAAAGGGAGAGGGGATGG + Intergenic
1133314763 16:4875750-4875772 TTAGAGAGATGGAGAGGCAAGGG - Intronic
1133397673 16:5461374-5461396 TTCTAGACTTGGAGAGGCGAGGG + Intergenic
1133485524 16:6215078-6215100 GGAGAGAGAAGGAGAGGAGAAGG + Intronic
1134745856 16:16587719-16587741 GTATAGAGAGAGAGAGGGGAAGG + Intergenic
1134793388 16:17011751-17011773 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1134892917 16:17856971-17856993 TTAAATATATGGAGAAGAGAAGG - Intergenic
1134999623 16:18766023-18766045 GTATAGAGAGAGAGAGGGGAAGG - Intergenic
1135149799 16:19995395-19995417 TTATAGAGAGGGTCAGAAGAGGG - Intergenic
1135299835 16:21316433-21316455 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1136268193 16:29132935-29132957 TGACAGAGATGGAGGAGAGACGG - Intergenic
1136351121 16:29708794-29708816 TTAGGCAGATGGAGAGGAAAAGG + Intergenic
1136624727 16:31455271-31455293 TTATGCAATTGGAGAGGAGAGGG + Intergenic
1137923278 16:52513458-52513480 TTATAGAAATCTAGATGAGATGG + Intronic
1137967393 16:52949796-52949818 TCACAGAGATAGAGAGTAGAAGG - Intergenic
1138436270 16:57001930-57001952 TCATGGAGATAGAGAGTAGAAGG - Intronic
1138604257 16:58077744-58077766 GAAGACAGATGGAGAGGAGAGGG + Intergenic
1138639091 16:58368583-58368605 TTATAGAGGCAGAGAGGAGATGG - Intronic
1138934929 16:61707222-61707244 TAATAGAGAGGAAGAGGACAAGG + Intronic
1138951305 16:61916685-61916707 TAATAGATATGGAAAGGAGAGGG + Intronic
1139422298 16:66856168-66856190 TTGAGGAGATGGTGAGGAGAGGG + Intronic
1139506538 16:67400785-67400807 TTACTGAGAAGGTGAGGAGAAGG - Intronic
1139944427 16:70630036-70630058 TCATGGAGATAGAGAGTAGAAGG - Intronic
1140318880 16:73928324-73928346 TTATAAAGGTGGAAAGAAGAAGG - Intergenic
1140544678 16:75795664-75795686 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1140624233 16:76772236-76772258 TTAGGGACATAGAGAGGAGAAGG - Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1140972159 16:80023858-80023880 TTCCAGGGAGGGAGAGGAGAAGG - Intergenic
1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG + Intergenic
1141267328 16:82508861-82508883 TTATGGAGAAGGGGAAGAGATGG + Intergenic
1141862090 16:86724535-86724557 TCATAGAGACGGAAAGTAGAAGG + Intergenic
1142071504 16:88093273-88093295 TGACAGAGATGGAGGAGAGACGG - Intronic
1142609438 17:1100541-1100563 TTTTGGAGTTGGAGAGGAAAGGG - Intronic
1143044913 17:4070104-4070126 GAAAAGAGATGGTGAGGAGAAGG + Intronic
1143262000 17:5606452-5606474 GTATATATCTGGAGAGGAGATGG + Intronic
1143303107 17:5925450-5925472 TCATAGAGTTGTGGAGGAGAGGG + Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143411841 17:6713811-6713833 GTAAGGAGATGGAAAGGAGAGGG - Intergenic
1143415547 17:6746371-6746393 TTATAGAGACAGAGAGTAGAAGG + Intergenic
1143420343 17:6786307-6786329 TCATGGAGATAGAGAGTAGAAGG + Intronic
1143566815 17:7727101-7727123 TTCTACAGAAGGAGAGCAGAGGG - Exonic
1144227554 17:13164886-13164908 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1146627815 17:34447321-34447343 TTATAGAAATGGAGAGATTAGGG + Intergenic
1146745502 17:35325062-35325084 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147522531 17:41188233-41188255 TTATAGTGAAGGAGAGGATGGGG - Intergenic
1147769405 17:42857153-42857175 CCATAGGGCTGGAGAGGAGACGG - Exonic
1148242067 17:46006390-46006412 TCATGGAGATAGAGAGTAGAAGG + Intronic
1149092447 17:52800408-52800430 TTATGGAGATTGAGAATAGAAGG - Intergenic
1149142841 17:53455242-53455264 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1149241124 17:54650895-54650917 TCATAGAAATAGAGAGTAGAAGG - Intergenic
1149649337 17:58267263-58267285 TGATAGAGCTGGAGTGGACATGG + Intronic
1149902877 17:60497308-60497330 TCATGGATATAGAGAGGAGAAGG + Intronic
1149950996 17:60985700-60985722 TCATGGAGATAGAGAGTAGAAGG - Intronic
1150004053 17:61458667-61458689 TTTTACAGATGGAGTGGGGAGGG - Intronic
1150156326 17:62856643-62856665 TTGTAGAGCTGGAAAAGAGAGGG + Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150829261 17:68504648-68504670 TGATGGAGATAGAGAGCAGAAGG + Intergenic
1151110425 17:71669771-71669793 ATATAGAGAAGGAGATGATATGG - Intergenic
1151150553 17:72082098-72082120 TGAGAGAGATGGAGGGAAGAGGG - Intergenic
1151251781 17:72841509-72841531 TCATGGAGATAGAGAGGAGAAGG + Intronic
1152006589 17:77686004-77686026 ATAGAGAGATGGAGAGTGGATGG - Intergenic
1153266469 18:3275276-3275298 TCATGGAGATGGAAAGTAGAAGG + Intronic
1153370485 18:4309898-4309920 CTCTAGAGGTGGAGAAGAGATGG - Intronic
1153504172 18:5779110-5779132 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154936928 18:21069626-21069648 TTATAGAGATGGTGTAGATAAGG - Intronic
1155117188 18:22780844-22780866 TGATAGAGATGTAGAGAAGCTGG - Intergenic
1155282858 18:24258433-24258455 ACATGGAGATAGAGAGGAGAAGG + Intronic
1155309208 18:24507887-24507909 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1156006820 18:32452060-32452082 TTCTTGAGAAGGAGAAGAGATGG + Intronic
1156124404 18:33886130-33886152 TTATGGACATAGAGAGTAGAAGG + Intronic
1156225432 18:35101566-35101588 TCATAGGCATGGAGAGTAGAAGG - Intronic
1156272802 18:35552507-35552529 TTATTGAAATAGAAAGGAGAAGG + Intergenic
1156461321 18:37322876-37322898 TTTTAGAGATGGAGAGGCTGAGG + Intronic
1156609190 18:38706632-38706654 TTCTAGAGCTGGCGAGGGGAAGG - Intergenic
1156613608 18:38756476-38756498 TAATAGAGATGAAGGGGAGAAGG + Intergenic
1156635504 18:39023597-39023619 TTGCACAGATGGAGAGGAGAAGG + Intergenic
1156875920 18:42011488-42011510 TTATAGAAATGGAGAGAATTAGG + Intronic
1156911901 18:42420883-42420905 TTATGCAGATAGAGAGTAGAAGG - Intergenic
1156993364 18:43437300-43437322 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1157953810 18:52071862-52071884 TCATAGAGATGGAGAGTAGTAGG - Intergenic
1158163440 18:54512157-54512179 TCATGGACATGGAGAGTAGAAGG + Intergenic
1158221101 18:55151593-55151615 TTTTAGAAATGGAGTGGGGATGG + Intergenic
1158948479 18:62468681-62468703 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1158987627 18:62834875-62834897 TCTTAGGGATGGAGAGGAGTGGG - Intronic
1159081027 18:63736355-63736377 TTATGGAGATAGAGAATAGAAGG + Intergenic
1159270789 18:66147580-66147602 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1159394274 18:67835934-67835956 TAACAGAGATAGAGAGTAGAAGG - Intergenic
1159510011 18:69385016-69385038 TTATTTAGATGGAGAGGGCAAGG + Intergenic
1159777958 18:72625358-72625380 TTAGAGAGATGGGGAGGAGGAGG - Intronic
1159902722 18:74063201-74063223 TTTTAAAGAGGAAGAGGAGATGG - Intergenic
1160640899 19:134984-135006 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1160783591 19:889548-889570 TGCTGGTGATGGAGAGGAGAGGG + Intronic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1162045249 19:7995317-7995339 TTAGAGAAAGGGCGAGGAGAAGG - Intronic
1162223645 19:9201157-9201179 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1162461090 19:10814641-10814663 TCACAGAGGTGGAGAGTAGAAGG - Intronic
1162614856 19:11790954-11790976 TCATAGAGATAGAGAGTAGAAGG + Intergenic
1162698284 19:12494579-12494601 TCATGGAGATAGAGAGTAGAAGG + Intronic
1163153483 19:15428106-15428128 CTACAGAGGTTGAGAGGAGACGG + Intronic
1163185647 19:15637436-15637458 TCATGGAGATAGAGAGTAGAAGG - Intronic
1163671963 19:18634724-18634746 TTAGGAAGAGGGAGAGGAGAGGG - Intergenic
1164434107 19:28213777-28213799 TAACAGAGAAGGAGAAGAGAGGG + Intergenic
1164508690 19:28880076-28880098 TCACAGAGATAGAGAGCAGAAGG - Intergenic
1164633381 19:29776036-29776058 TTTTGCAGATGGAAAGGAGAAGG + Intergenic
1165990352 19:39808295-39808317 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1166184593 19:41131588-41131610 GAAAAGAGATGGAGAGGAAAAGG + Intergenic
1166411444 19:42558077-42558099 TTAGGGAGATAGAGAGGAAAGGG + Intronic
1167076123 19:47250486-47250508 TAATAGAGATGGGGATGGGAGGG + Intergenic
1167138755 19:47634636-47634658 TTACTGAGATGGAGAGAAGCAGG - Intronic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925572111 2:5323566-5323588 TTAAAGAGATGCAGATGGGAAGG + Intergenic
926529786 2:14030194-14030216 TTATAGAGAAGGAAAGTTGAAGG + Intergenic
927153604 2:20209525-20209547 TTTGAGAGGTGGAGAGGAAATGG + Intronic
927232672 2:20840243-20840265 TTATGGAGATAGAGAGTAAAAGG + Intergenic
927318000 2:21708224-21708246 GAAAAAAGATGGAGAGGAGAGGG + Intergenic
928001897 2:27530718-27530740 TTATGGAGATAGAGAATAGAAGG + Intergenic
928510237 2:31996166-31996188 GGAGAGAGAGGGAGAGGAGAGGG + Intronic
928932972 2:36644662-36644684 TTATGGAGATGGAGAATAGAAGG + Intronic
929113471 2:38424853-38424875 TTATAAACGTGGAGAGCAGAAGG + Intergenic
929388173 2:41436171-41436193 TTATGGATATAGAGAGTAGAAGG - Intergenic
929467483 2:42158372-42158394 TCATGGAGATAGAGAGTAGAAGG + Intergenic
929804242 2:45130714-45130736 TTATAGACTTGAAGGGGAGATGG + Intergenic
929973280 2:46604669-46604691 TCATGGAGATAGAGAGTAGAAGG + Intronic
930229824 2:48832112-48832134 TCATGGAGATAGAGAGTAGAAGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930967591 2:57349914-57349936 TTATAGATAAGCAGATGAGAAGG + Intergenic
931572890 2:63688456-63688478 TCATGGAGATAGAGAGTAGAAGG + Intronic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932377752 2:71253082-71253104 GTATAGGTAAGGAGAGGAGAGGG + Intergenic
932433303 2:71688064-71688086 TTCTGGAGAAGGAGAGGAGGGGG + Intergenic
932988894 2:76762350-76762372 TTATAGAAATGGTGTGGAGGAGG - Intronic
933348640 2:81124460-81124482 TCATGAAGATGGAGAGTAGAAGG - Intergenic
933491877 2:82995115-82995137 TCATTGAGATGGAGAAGAGTGGG + Intergenic
933601549 2:84337190-84337212 TCATGGAGATGGAGAATAGAAGG + Intergenic
933627432 2:84617578-84617600 TCATGGAGATAGAGAGGAGAAGG - Intronic
934075286 2:88423157-88423179 TGAGAAAGATGGAGAGGAGTGGG + Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934656955 2:96121378-96121400 CTACAGAGATGGACAGGAGCAGG - Intergenic
934851460 2:97704344-97704366 TCATGGAGATAGAGAGTAGAAGG - Intergenic
935010120 2:99126456-99126478 TTTGAAAGGTGGAGAGGAGAAGG - Intronic
935206705 2:100902513-100902535 TTATAGAGACAGAAAGTAGAAGG + Intronic
935442542 2:103118390-103118412 TCATGGAGATAGAGAGCAGAAGG + Intergenic
935584573 2:104789102-104789124 GGAGAGAGATGGAGAGGAAAGGG - Intergenic
935627372 2:105182412-105182434 TCATAGAGATAGAGAGTAGAAGG - Intergenic
935714775 2:105930323-105930345 TTCTAGAGAGGGAGAGGACCTGG + Intergenic
936092398 2:109509972-109509994 TTATCTAGTTGGAGAGGTGAGGG + Intergenic
936970345 2:118170784-118170806 TTTTAAAGATGTAGAAGAGAGGG - Intergenic
937349745 2:121153365-121153387 CCATAGAGATGAAGAGGAGATGG - Intergenic
937615643 2:123918925-123918947 TTATAGAGATAGAGAAAAAAGGG - Intergenic
937627902 2:124064446-124064468 TAATAGAAATGGAGAGAAGCAGG - Intronic
937628714 2:124074150-124074172 TTATGGATATAGAGAGTAGAAGG + Intronic
937736259 2:125294404-125294426 TCATAGAGATAGAGAGTAGAAGG - Intergenic
937786372 2:125904337-125904359 TTAGAGAGAGGCAGTGGAGAGGG - Intergenic
938980507 2:136521806-136521828 TTACAGAGATGCTGAGAAGATGG - Intergenic
939309882 2:140462378-140462400 TTATAGAGATGGACATGCAAAGG + Intronic
940234241 2:151492561-151492583 AGATAGAGATGGATAGGAGCTGG + Intronic
940314456 2:152312794-152312816 TCATGGAGATAGAGAGCAGAAGG - Intergenic
940434927 2:153640153-153640175 TTCTAGAGATAGAGACAAGAGGG - Intergenic
940446082 2:153778694-153778716 TAATAGAGATTGAGAAGAGTTGG - Intergenic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
940559346 2:155274735-155274757 TCATGGAGATAGAGAGTAGAAGG - Intergenic
941042370 2:160636861-160636883 TCATGGAGATAGAGAGTAGAAGG - Intergenic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942479926 2:176374260-176374282 TCATAGAGATAGAGAGTAGAGGG + Intergenic
942529670 2:176895951-176895973 TCATGGAGATGGAGAATAGAAGG - Intergenic
942750568 2:179282323-179282345 CCATAGAGATAGAGAGTAGAAGG + Intergenic
942780624 2:179637649-179637671 TTTTACAGATGAAGAGGACAAGG + Intronic
943151285 2:184116499-184116521 TTGGAGAGGTGGAGAGGTGATGG + Intergenic
943207730 2:184921805-184921827 TCACGGAGATGGAGAGTAGAAGG - Intronic
943374995 2:187065742-187065764 TCGTAAAGATGGAGAAGAGAAGG - Intergenic
943581260 2:189685869-189685891 TTTTAGTGAGGAAGAGGAGAAGG + Intronic
943889408 2:193267627-193267649 TTATAAAGGTTGAGAGGAAAGGG + Intergenic
944361257 2:198860076-198860098 TCATGGAGATAGAGAGTAGACGG + Intergenic
944463450 2:199976469-199976491 TCATGGAGATAGAGAGTAGAAGG - Intronic
944679372 2:202062972-202062994 TCCTAGGGATGGAGATGAGAAGG - Intergenic
944841990 2:203633235-203633257 TAAAAGAGAGGGAGAAGAGAAGG - Intergenic
945256927 2:207810813-207810835 TTCCAGGGCTGGAGAGGAGAGGG - Intergenic
945287812 2:208099648-208099670 TCATAAAGATAGAGAGTAGAAGG - Intergenic
945290401 2:208121113-208121135 TGATAGGGAGGGAGAAGAGATGG - Intergenic
945566011 2:211400586-211400608 TTATGGAGATAGAGAGTAGAAGG + Intronic
945713914 2:213334765-213334787 TAATGGAGATAGAGAGTAGAAGG + Intronic
945838838 2:214864776-214864798 TCATGGAGATAGAGAGTAGAAGG + Intergenic
945972998 2:216248376-216248398 TCATGGAGATAGAGAGTAGAAGG - Intergenic
946038544 2:216764369-216764391 TTTCAAAGATGGAGAGGAAAGGG - Intergenic
946039376 2:216770725-216770747 TTATAAAGAGGGAAAGGACAGGG - Intergenic
946133055 2:217622420-217622442 TTATACAGAACTAGAGGAGAGGG + Intronic
946994982 2:225381213-225381235 TCATGGAGATAGAGAGTAGAAGG - Intergenic
947159122 2:227194040-227194062 AGAAAGAGAAGGAGAGGAGAAGG + Intronic
947584926 2:231349383-231349405 TCATGGAGATAGAGAGTAGAAGG + Intronic
947686591 2:232091334-232091356 TCATGGAGATAGAGAGTAGAAGG - Intronic
948661998 2:239513300-239513322 AGATAGAGAGAGAGAGGAGAAGG - Intergenic
1168781357 20:493793-493815 TGATAGAGATAAAGAGCAGAGGG - Intronic
1168894836 20:1317042-1317064 TTATAGAGATGGAAAACAGAGGG + Intronic
1168906433 20:1407680-1407702 TAATAGAGATGGAGTGGGCATGG + Intergenic
1170236554 20:14112172-14112194 TCATGGAGATAGAGAGTAGAAGG + Intronic
1170545668 20:17433926-17433948 AGAGAGAGAGGGAGAGGAGAGGG - Intronic
1170700865 20:18702275-18702297 TTACAGAGATGGAGGGAAGGGGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170818082 20:19731950-19731972 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1171024924 20:21621568-21621590 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1171131340 20:22656350-22656372 TCATAGAGACAGAGAGTAGAAGG - Intergenic
1171314726 20:24179553-24179575 TTATTGAAATGGAGAAGACAGGG - Intergenic
1171405695 20:24910953-24910975 TTCAAGAGATGGAGAGCACAGGG - Intergenic
1171818297 20:29808669-29808691 TCATAGAGATAGAGAGTATAAGG - Intergenic
1171899505 20:30844311-30844333 TCATAGAGATAGAGAGTATAAGG + Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1172557624 20:35856137-35856159 TTACGGAGATAGAGAGTAGAGGG - Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1173235425 20:41240691-41240713 TTATCGAGATACAGAGTAGAAGG - Intronic
1173361957 20:42352538-42352560 TTACAGAGATAGAGAGTAGAAGG + Intronic
1173372894 20:42454472-42454494 TTATAAAGATGCGGAGGAGTAGG - Intronic
1173434463 20:43020051-43020073 AGAAAGAGAGGGAGAGGAGAGGG - Intronic
1173758109 20:45535848-45535870 AAATAAAGCTGGAGAGGAGAAGG - Intronic
1173875831 20:46370816-46370838 TTATTGTGAAGGAGAGGGGAAGG - Intronic
1174937906 20:54892758-54892780 TTACAGACATGGAGAACAGAAGG - Intergenic
1175028692 20:55930677-55930699 TTTTAGACATGGAGACCAGAAGG - Intergenic
1175395773 20:58660360-58660382 GTAGAGTGATGGAGAGGTGAGGG + Intronic
1175683765 20:61011123-61011145 CTATAGAGAGAGAGAGGAGAAGG - Intergenic
1177222522 21:18213012-18213034 TAATAGAGATGGAGATGTGATGG + Intronic
1177565048 21:22809867-22809889 TTATTAAGTTGGAGAGGAAATGG - Intergenic
1177778636 21:25598698-25598720 ATATTGAGAGGGAGAGAAGAGGG - Intronic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1178525278 21:33323658-33323680 ATATAGAGATGGAATAGAGATGG + Intergenic
1178799251 21:35777188-35777210 TGATAGAAAGGGAGAGAAGACGG - Intronic
1178808154 21:35856700-35856722 TCATGGAGATGGGGAGTAGAAGG + Intronic
1178808449 21:35859282-35859304 TCATGAAGATGGAGAGTAGAAGG + Intronic
1179220990 21:39407318-39407340 TTCTAGAGCTGGTGAGAAGATGG + Intronic
1179498384 21:41790521-41790543 TTATAGAGGTAGAGAGCAGATGG + Intergenic
1179919057 21:44497459-44497481 TAAAAGAGGAGGAGAGGAGAGGG - Intergenic
1180023400 21:45143639-45143661 TAACAGAGAGTGAGAGGAGACGG - Intronic
1180153705 21:45966765-45966787 TTAGAGTGAAGGACAGGAGAAGG - Intergenic
1180333316 22:11552591-11552613 TCATAGAGATAGAGAGTATAAGG + Intergenic
1180994460 22:19958701-19958723 TGGTAGAGATGGAGTGGAGGTGG - Intronic
1181680148 22:24489779-24489801 TCATGCAGATGGAGAGTAGAAGG + Intergenic
1181998688 22:26903103-26903125 TGAGAGCGATGGAGGGGAGAGGG + Intergenic
1182513836 22:30840484-30840506 TTAAAGAGATGGGAGGGAGATGG + Intronic
1183863766 22:40688139-40688161 TTATTGAACTGCAGAGGAGAAGG - Intergenic
1183913793 22:41100046-41100068 TTCTAGAGATGGTGGGGGGATGG - Intronic
1183923968 22:41192409-41192431 TTACAGAGGTGGAGAAGATAAGG + Intergenic
1184544592 22:45158242-45158264 TTATAGAGGTGGAGAGGTGGGGG - Intergenic
1185300717 22:50078967-50078989 TTATTAAGACGGAGAGCAGATGG - Intronic
949183049 3:1157682-1157704 TCATGGAGATAGAGAGTAGAAGG - Intronic
949329281 3:2903586-2903608 TTACAGAAATGAAGAGGGGAAGG - Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
951227604 3:20139078-20139100 TTGTAGAGATGGTGAGGGGTTGG + Intronic
952307955 3:32162024-32162046 CTATAGCAATGGAGAAGAGAAGG - Intronic
952538826 3:34344811-34344833 TCATGGAGATAGAGAGTAGAAGG + Intergenic
952726297 3:36589374-36589396 TCATGGAGATAGAGAGTAGAAGG + Intergenic
952806250 3:37355905-37355927 GTAAAGAGATTGGGAGGAGAAGG - Intronic
953087808 3:39689189-39689211 TTATAGACATGGAGAGTAGAAGG + Intergenic
953353889 3:42237939-42237961 TCATAGAGATAGAGAATAGAAGG + Intergenic
953380291 3:42465909-42465931 TCATTGAGATAGAGAGCAGAAGG + Intergenic
953706209 3:45232722-45232744 TTACAGAGATGCAGAAGAGATGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954980001 3:54737328-54737350 TGATAGATAAGGAGAGGAGGAGG + Intronic
955108863 3:55927782-55927804 TCATGGAGATAGAGAGTAGAAGG - Intronic
955180518 3:56664715-56664737 TTATAGGGATGTAGGTGAGATGG - Intronic
955570314 3:60298035-60298057 TGGAAGAGATGGAGAGGACAAGG + Intronic
955621811 3:60872465-60872487 TTAAAGAGAAGAAAAGGAGAAGG - Intronic
956173582 3:66452728-66452750 TTATAGAAGTGAATAGGAGAAGG + Intronic
956237020 3:67083755-67083777 TTAAAGACAGGCAGAGGAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956698212 3:71936522-71936544 TTAGAGAGCTGCAGAGGAGGAGG + Intergenic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
957000278 3:74876371-74876393 TAATAGAGATAGGGAGGAGCAGG - Intergenic
957088168 3:75702431-75702453 TCATAGAGATGGAGAGTATAAGG + Intergenic
957124585 3:76142623-76142645 TTATGGACATAGAGAGTAGAAGG + Intronic
957194001 3:77044480-77044502 AGAAAGAGAAGGAGAGGAGAAGG - Intronic
957864632 3:86005897-86005919 TCATGGAGATAGAGAGTAGAAGG - Intronic
958039009 3:88204083-88204105 TTATGGACATAGAGAGTAGAAGG + Intergenic
958100690 3:89005606-89005628 TCATGGAGATAGAGAGTAGAAGG - Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958526998 3:95274911-95274933 AGATAGAGAGTGAGAGGAGAAGG + Intergenic
958629802 3:96670813-96670835 TAATAGAGATCAAGAGGAGCAGG - Intergenic
958666101 3:97139463-97139485 CTAAAGAGATGGGGAGGTGAAGG - Intronic
958740171 3:98059614-98059636 TTGTTGAGATGGAGACTAGATGG + Intergenic
959307148 3:104682181-104682203 TCATGGAGATAGAGAGTAGAAGG + Intergenic
959408431 3:105990373-105990395 TCATGGAGATAGAGAGTAGAAGG - Intergenic
959717971 3:109454385-109454407 TCATGGAGATAGAGAGTAGAAGG + Intergenic
959991998 3:112640335-112640357 TCATAGAGATGGAATGCAGAGGG + Exonic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960208732 3:114934035-114934057 TTCCAGAGATGGAGAGGTGCTGG - Intronic
960242106 3:115356532-115356554 TCATAGATATAGAGAGTAGAAGG + Intergenic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960505713 3:118490919-118490941 TTATGGAAATAGAGAGTAGAAGG + Intergenic
960686488 3:120299626-120299648 TTAGAGAGAAGTAGAGTAGAGGG - Intergenic
960694578 3:120383530-120383552 TTATAGAGGTGTAGAGGCCAGGG + Intergenic
960861513 3:122158920-122158942 TCATGGAGATAGAGAGTAGAAGG - Intergenic
961027185 3:123568573-123568595 CCATTGAGATGGAGTGGAGATGG - Intronic
962402517 3:135072713-135072735 TAACAAAGATGGAGAAGAGAGGG - Intronic
962418437 3:135204972-135204994 TCATGGAGATAGAGAGTAGAAGG - Intronic
962484462 3:135828958-135828980 TCAAAGAGATAGAGAGTAGAAGG + Intergenic
962717069 3:138135703-138135725 TTACATGAATGGAGAGGAGATGG + Intergenic
963168718 3:142230275-142230297 TCATGGAGATAGAGAGTAGAAGG - Intergenic
963249535 3:143090329-143090351 ATATAGAGAAGGAAAGGGGAGGG - Intergenic
963313951 3:143738848-143738870 TGAAAGAGATGCACAGGAGAAGG + Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964781620 3:160345397-160345419 TCATGGAGATAGAGAGTAGAAGG + Intronic
964890398 3:161527648-161527670 TTATCTAGATGGAGAGAAGGAGG + Intergenic
965255500 3:166403103-166403125 TTTTAGAGATGGAGCCAAGATGG - Intergenic
965725635 3:171712298-171712320 TTCTAGGGATGGAGACGAGAGGG + Intronic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
965987466 3:174773224-174773246 GTATAGAAATAGAGAGGAGAAGG + Intronic
965992419 3:174836288-174836310 TTATAGAGATAGAGAGTAGAAGG + Intronic
966233527 3:177674713-177674735 GTAGAGAGAGGGAGAGGGGAAGG - Intergenic
966243487 3:177780525-177780547 TTATGTAGATAGAGATGAGATGG + Intergenic
966423371 3:179755951-179755973 TTATAGAGAAAGAGCAGAGAAGG + Intronic
966679631 3:182627835-182627857 TCATGGAGATAGAGAGTAGAAGG - Intergenic
967097909 3:186192952-186192974 GGATAGAGATGGAGGGGACAGGG - Intronic
967269290 3:187719765-187719787 ATAGAGAGATGGAGGGGCGAGGG - Intronic
967452964 3:189647765-189647787 CTATAGCGATGGATGGGAGAAGG - Intronic
967502305 3:190212938-190212960 TTATGGACATAGAGAGTAGAAGG + Intergenic
967768256 3:193305945-193305967 TTATAGATGTGAAAAGGAGATGG + Intronic
967779888 3:193425708-193425730 GAATAGAGATAGAGAGGAGAAGG + Intronic
968385967 4:138315-138337 TCATAGAGACAGAGAGCAGAAGG - Intronic
968391174 4:194084-194106 TAATAGAGATCAAGAGGAGCAGG - Intergenic
968879181 4:3290402-3290424 TTATAGAGACGGATAGTAGAAGG - Intergenic
969593684 4:8136246-8136268 TCATAGAGATGGAAAGTAGAAGG + Intronic
969820682 4:9717925-9717947 TAAAAGAGATGGAGAGGAAGGGG - Intergenic
970211640 4:13716046-13716068 TTATAGAGCTGGTGGGAAGATGG + Intergenic
970377520 4:15474403-15474425 TCATGGAGATAGAGAAGAGAAGG + Intronic
970725231 4:19036233-19036255 TTATAGAGATGGATGGAAAAGGG - Intergenic
971137677 4:23887749-23887771 TTAAAGAGAGAGAGAGAAGAAGG + Intronic
971248928 4:24955680-24955702 TTATAGAGACAGAAAGTAGAAGG + Intronic
971868150 4:32199821-32199843 TTATAGGGTTAGAGAAGAGAAGG + Intergenic
972676633 4:41266092-41266114 GTATAGAGATGGGGCGGGGAGGG + Intronic
972835963 4:42870029-42870051 TTATGGTGATGAAGAGGAGGAGG - Intergenic
972928863 4:44046855-44046877 ACATAGAGATAGAGAGTAGAAGG + Intergenic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973765535 4:54158346-54158368 TTAAGGAGAAGGAGAGGAGGAGG + Intronic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
974285267 4:59856747-59856769 TTATAGAAATAAAGAGGAAAAGG - Intergenic
974290566 4:59924491-59924513 TCATGGAGATAGAGAGTAGAAGG + Intergenic
974311157 4:60211090-60211112 TAAGAGAGAGAGAGAGGAGAAGG + Intergenic
974369568 4:60998158-60998180 TCATGGAGATAGAGAGTAGAAGG - Intergenic
974819652 4:67050005-67050027 TTATATGAAAGGAGAGGAGATGG + Intergenic
974920472 4:68233086-68233108 TTAGAGAGAAGGAGAAGAGGAGG + Intronic
975231479 4:71939356-71939378 ATAGAGAGAGGGAGAGAAGATGG - Intergenic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975463103 4:74677515-74677537 TCATAGAGATAGAAAGTAGAAGG - Intergenic
975630266 4:76394441-76394463 TCATGGAGATAGAGAGTAGAGGG + Intronic
976389889 4:84497180-84497202 TTAGAAAGATGGGGAGGAGAGGG - Intronic
976615190 4:87069207-87069229 TTATACAGAGGGAGGGGACATGG - Intronic
976619124 4:87110546-87110568 TCATGGAGATAGAGAGTAGAAGG - Intronic
976902590 4:90197206-90197228 TTAAAGAGATGGATAGGTTAAGG + Intronic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
977752002 4:100620786-100620808 TTAGACAGATAGAGAGGAAAAGG - Intronic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
977850329 4:101819912-101819934 TTGTAGAAAAGAAGAGGAGAAGG + Intronic
978008379 4:103648466-103648488 TCATGGAGATAGAGAGTAGAAGG - Intronic
978105574 4:104898132-104898154 TAATAGAAATGTAGAGGAGTGGG + Intergenic
978978653 4:114914143-114914165 TCATGGAGATAGAGAGTAGAAGG + Intronic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
979847311 4:125531961-125531983 TCATGGAGATAGAGAGTAGAAGG - Intergenic
979859296 4:125674149-125674171 TTATGGAGATGTAAAGAAGAGGG + Intergenic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980463395 4:133146983-133147005 TTCCAGAGGTGGAGATGAGATGG - Intergenic
980753237 4:137120276-137120298 TCATGAAGATGGAGAGTAGAAGG + Intergenic
981203248 4:142008662-142008684 TCATGGAGATAGAGAGTAGAAGG - Intergenic
981592179 4:146376281-146376303 TTATTGATATGGATAGGAGGAGG + Intronic
981725660 4:147844510-147844532 TCATGGAGATAGAGAGTAGAAGG - Intronic
981954720 4:150455848-150455870 TAATGGAGATAGAGAGTAGAAGG - Intronic
982532878 4:156569655-156569677 TTAGAGAGAGAGAGAGAAGAAGG - Intergenic
983188599 4:164729593-164729615 TTATAGAGCTGAAAAAGAGATGG + Intergenic
983379648 4:166975693-166975715 TCATAGAGATAGAGAGTAGAAGG - Intronic
983486501 4:168337805-168337827 TTAGAGAGATAGAGAAGAGGAGG - Intergenic
983586584 4:169362274-169362296 TCATGGAGATAGAGAGTAGAAGG + Intergenic
983708929 4:170690717-170690739 TTTTATAGATGGAAAGGAGAAGG - Intergenic
984239259 4:177197944-177197966 TCATGGACATGGAGAGTAGAAGG - Intergenic
984354875 4:178645143-178645165 TCATGGAGATTGAGAGTAGAAGG - Intergenic
984457513 4:179988848-179988870 TTGGAGAGATCCAGAGGAGAGGG + Intergenic
984498083 4:180523834-180523856 TTATAGAGAAAGAGAGTAGCAGG + Intergenic
984627569 4:182024862-182024884 TTATGGAGATAGAGAGTAGAAGG - Intergenic
984941476 4:184936030-184936052 TTAGGCAGATAGAGAGGAGAAGG + Intergenic
985028370 4:185762437-185762459 TTACAGAGATTTAGACGAGAGGG + Intronic
985230078 4:187806266-187806288 TCATGGAGATTGAGAGTAGAAGG + Intergenic
985325875 4:188769600-188769622 TAATAGAGAGGTAGAGGAGACGG - Intergenic
985442761 4:189996097-189996119 TCATAGAGATAGAGAGTATAAGG - Intergenic
986198202 5:5557349-5557371 TCATGGAGATAGAGAGTAGAAGG - Intergenic
986426416 5:7636188-7636210 TTACAGATCTGGAGAAGAGAGGG + Intronic
987162409 5:15157763-15157785 TTAAAGGGATGGGGACGAGAAGG + Intergenic
987353088 5:17038532-17038554 TTAGAGGGAGAGAGAGGAGAGGG - Intergenic
988096916 5:26626723-26626745 TTACTGAGATGGAGAGCAAATGG + Intergenic
988207080 5:28152351-28152373 TCATAGAAATGGAGAGTAGAGGG - Intergenic
988692156 5:33583171-33583193 TTATGGACATAGAGAGTAGAAGG - Intronic
988855345 5:35222851-35222873 TTGTAAAGTTGGAGAGGTGAGGG + Intronic
989084391 5:37659738-37659760 TGAAAGAGATGGAGTGGAGTAGG + Intronic
989786090 5:45332511-45332533 TCATGGAGATAGAGAGTAGAAGG - Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990524545 5:56611991-56612013 TCATGGAGATGGAGAGTGGAAGG + Intergenic
990836015 5:60021096-60021118 TTATAAAGATAGATAGGAAAGGG + Intronic
990893233 5:60670749-60670771 TTATAGAGATGGGAAGCACAGGG - Intronic
990932307 5:61106726-61106748 TTATGGAGATAGAGAGTAGAAGG - Intronic
991185329 5:63800058-63800080 TTAAAGACATTGAGAGGAGGAGG - Intergenic
991238416 5:64426795-64426817 TCATAGAGACAGAGAGCAGAAGG + Intergenic
991238421 5:64426853-64426875 TCATGAAGATGGAGAGTAGAAGG + Intergenic
991316854 5:65318691-65318713 TTATGGACATAGAGAGTAGAAGG + Intronic
991573182 5:68076738-68076760 TTATAGTCAATGAGAGGAGATGG - Intergenic
991597035 5:68316321-68316343 TGAAAGAGAGGGAGAGGGGAAGG + Intergenic
991938051 5:71822093-71822115 TCATGGAGATAGAGAGTAGAAGG - Intergenic
992587786 5:78259330-78259352 TTATGGACATAGAGAGTAGAAGG + Intronic
993107346 5:83614215-83614237 ATACAGAGATGAAAAGGAGAGGG - Intergenic
993235217 5:85297072-85297094 TCATGGAGATAGAGAGTAGAAGG - Intergenic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
994247464 5:97496176-97496198 TTACACAGATGGGGAAGAGAGGG - Intergenic
994274296 5:97816582-97816604 TCATGGAGATAGAGAGTAGAAGG - Intergenic
994399450 5:99260916-99260938 TCATGGAGATAGAGAGTAGAAGG + Intergenic
994457740 5:100034151-100034173 TCATGGAGATAGAGAGTAGAAGG + Intergenic
994596740 5:101847634-101847656 TCATATAGATAGAGAGTAGAAGG - Intergenic
994613596 5:102077201-102077223 TTAGAGAGAAGGAGGGAAGAGGG + Intergenic
994660511 5:102648357-102648379 TCATGGACATGGAGAGTAGAAGG + Intergenic
995322133 5:110847419-110847441 TCATGGAGATAGAGAGTAGAAGG - Intergenic
995528824 5:113072941-113072963 TTACTGAGATGGAGAAGATAAGG - Intronic
995603336 5:113823078-113823100 TTCTAGGGATGGATGGGAGAGGG + Intergenic
995692081 5:114838629-114838651 TCATGGAGATAGAGAGTAGAAGG + Intergenic
995747546 5:115419316-115419338 TGAGAGAGATGGAGAGGAAAGGG + Intergenic
995885325 5:116888145-116888167 TTATAGAAAGGGAGAGCAGCAGG + Intergenic
995916946 5:117258586-117258608 TTCTGCAGATGGAGAGGAAATGG + Intergenic
996025043 5:118636329-118636351 TCATGGAGATAGAGAGTAGAAGG + Intergenic
996224852 5:120979576-120979598 TTATAGAGATGAACCGGAAAAGG + Intergenic
996540005 5:124620737-124620759 TAATAAAAATTGAGAGGAGAAGG + Intergenic
996688280 5:126309362-126309384 TCATGGAGATAGAGAGCAGAAGG + Intergenic
996968772 5:129337943-129337965 TCATGGAGATAGAGAGTAGAAGG + Intergenic
997511110 5:134455179-134455201 TTATAGAGACAGAAAGTAGAAGG + Intergenic
997820496 5:137061730-137061752 TTCTAGAGATAGAGTGGAGGGGG + Intronic
997870765 5:137503340-137503362 TTATGGACATAGAGAGTAGAAGG - Intronic
998350249 5:141495570-141495592 AGACAGAGATGGAGAAGAGAGGG - Intronic
998866320 5:146506693-146506715 TCATAGAAATAGAGAGTAGATGG - Intronic
998877669 5:146617184-146617206 TCATGGAGATAGAGAGTAGAAGG + Intronic
998997571 5:147882329-147882351 TTAGAGATAAGGAAAGGAGAAGG - Intronic
999329000 5:150660241-150660263 ACAAGGAGATGGAGAGGAGAGGG - Intergenic
999454213 5:151701552-151701574 TTATAGAGATGCGGGGGAGGGGG + Intergenic
999788989 5:154920052-154920074 TTATACAGCTGTGGAGGAGAAGG - Exonic
999875634 5:155802789-155802811 TTTTAGAGTTGGAGAAGAGATGG + Intergenic
1000210029 5:159100199-159100221 AAAGAGAGATAGAGAGGAGAGGG + Intergenic
1000249725 5:159482555-159482577 GTATAGAGATGGAGAGGGAGCGG - Intergenic
1000440328 5:161255250-161255272 TTATAGAGATGAATTGGAGGTGG + Intergenic
1002490033 5:179569278-179569300 TGAAAGAGATGGACAGGACAGGG - Intronic
1002736451 5:181391437-181391459 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1002748246 6:83387-83409 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1002766540 6:244800-244822 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1003161825 6:3642605-3642627 TCATAGAGATGGAAAGTAGAAGG + Intergenic
1003219763 6:4148778-4148800 TCATAGATATAGAGAGTAGAAGG - Intergenic
1003542878 6:7033488-7033510 ATTTAGAGATGGAGAGAGGAGGG - Intergenic
1004331468 6:14725939-14725961 TGATAGGGATGTCGAGGAGAGGG - Intergenic
1005001311 6:21244521-21244543 TTAGGGAGATGGAGGGGAGAGGG - Intergenic
1006462009 6:34165031-34165053 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007497852 6:42273537-42273559 TTACAGAGGTGGAGAGGACCAGG + Intronic
1007795440 6:44343137-44343159 TGCTTGAGATGGAGGGGAGACGG - Exonic
1007940313 6:45774437-45774459 TTATAGATTTTGGGAGGAGAGGG - Intergenic
1008120638 6:47612816-47612838 TCATAGAGATAGAGAACAGAAGG + Intronic
1009003999 6:57759049-57759071 TCATAAAGATAGAGAGTAGATGG - Intergenic
1009447966 6:63765826-63765848 TCATGGAGATAGAGAGCAGAAGG - Intronic
1010837004 6:80600746-80600768 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1010984913 6:82412648-82412670 GTACAAAGAGGGAGAGGAGAAGG + Intergenic
1011191815 6:84737519-84737541 CTACAGAGATGAAAAGGAGATGG + Intronic
1011354540 6:86460543-86460565 TTATAAATATGGAAAGGAAAGGG - Intergenic
1011385472 6:86792974-86792996 TCATAGAGATGGAGAGTAGAAGG - Intergenic
1011654623 6:89539822-89539844 TTATGGACATAGAGAGTAGAAGG - Intronic
1012028857 6:94032361-94032383 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1012099860 6:95018896-95018918 TTCTAGAGATGAAGGGCAGATGG - Intergenic
1012548973 6:100450452-100450474 GTAGAGAGATGGAGTGGAGCAGG + Intronic
1012744781 6:103072053-103072075 TCATAGAGATAGTGAGTAGAAGG + Intergenic
1013176214 6:107679581-107679603 TGACAGAGCTGGAGAGGAGGAGG + Intergenic
1013647795 6:112162606-112162628 TTATTGAGATGGAGAAGACTGGG + Intronic
1013875196 6:114817419-114817441 ATATAGAGAAGAGGAGGAGAAGG - Intergenic
1014060508 6:117066091-117066113 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014382413 6:120758891-120758913 TAATAGAGGCTGAGAGGAGAAGG + Intergenic
1014684407 6:124477802-124477824 AGAGAGAGATGGAGAGGAGGGGG - Intronic
1014816361 6:125940088-125940110 TAATAGTGATGAAGAGGAGGAGG + Intergenic
1015115218 6:129641085-129641107 ATATAGAGTTGGACAGTAGATGG - Intronic
1015351286 6:132223151-132223173 TTAAAGAGATTTTGAGGAGAGGG + Intergenic
1015854587 6:137609869-137609891 TTATATTGTTGGATAGGAGAAGG + Intergenic
1016075743 6:139793845-139793867 TTATGGACATAGAGAGTAGAAGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1016720993 6:147297004-147297026 TTATAGAGGGTGAGAAGAGATGG + Intronic
1016754415 6:147668199-147668221 GTATATAGATGCACAGGAGAAGG - Intronic
1017038399 6:150287606-150287628 TTATAGAGATTGAGAGTGCAAGG - Intergenic
1017307324 6:152934259-152934281 TTAAAGAAATGGAGAACAGAAGG + Intergenic
1017308758 6:152952423-152952445 TTATAGATATGGAGATTGGAGGG - Intergenic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017846705 6:158264773-158264795 TTAGAGGCATGGAGAAGAGAGGG - Intronic
1018042961 6:159941208-159941230 TTCTAGGGATGGAGAGGGCAGGG + Intergenic
1018361440 6:163074385-163074407 TCATGGAGATAGAGAGTAGAAGG + Intronic
1018536204 6:164822741-164822763 CCACAGAGATGGAGAGTAGAAGG + Intergenic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019241549 6:170666966-170666988 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1019353637 7:567827-567849 TCATAGAGACAGAAAGGAGAAGG + Intronic
1020218204 7:6212106-6212128 TCATGGAGATAGAGAGTAGAAGG - Intronic
1020426715 7:8074940-8074962 GGATAGACATGGAGGGGAGAGGG + Intronic
1020704533 7:11527765-11527787 TGATATAGAAAGAGAGGAGAGGG - Intronic
1020890282 7:13869586-13869608 GTATAGATGTGAAGAGGAGAAGG - Intergenic
1021377412 7:19924919-19924941 TTATAGAAGTGGAAAGGAAAAGG + Intergenic
1021436677 7:20625276-20625298 TTATAAAGCAGGAGAGGAGCCGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021884196 7:25122455-25122477 TTATGGAGATGGTGAGCACAAGG - Exonic
1022385708 7:29897020-29897042 TAATAGAGACAGAGAGTAGAAGG - Intronic
1022620937 7:31984079-31984101 TGATAGAGGTGGAGAGGAAAGGG + Intronic
1022669491 7:32442505-32442527 TTATACAGATGAAGAGCTGAAGG - Intergenic
1023156870 7:37260299-37260321 TTTTAGAGAGGGAGAAGATAGGG + Intronic
1023421540 7:39985149-39985171 TCATGGAGATAGAGAGTAGAAGG - Intronic
1024459480 7:49645338-49645360 TTATAGAGATGGGGAGGAGGCGG - Intergenic
1024896817 7:54270028-54270050 GTATATATGTGGAGAGGAGAAGG - Intergenic
1024968729 7:55049615-55049637 TCAGAGAGCTGGAGAGGGGAGGG - Intronic
1025065668 7:55853488-55853510 TCATAGAGATAGAGAGTGGAAGG + Intronic
1025764564 7:64430790-64430812 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1026178933 7:68021854-68021876 TCAAAGAGAAGCAGAGGAGAAGG - Intergenic
1026315400 7:69223234-69223256 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1026338125 7:69412212-69412234 TTGTAGAGATAGGGAGGAGGGGG - Intergenic
1026618646 7:71930826-71930848 TTTTAAAGATGGAGAAGAGAAGG - Intronic
1026663486 7:72322622-72322644 TCATAGAGATAGAGAGTAGAAGG + Intronic
1027129870 7:75583155-75583177 GCAGAGAGATGGGGAGGAGAGGG - Intronic
1028008087 7:85603927-85603949 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1028026262 7:85844326-85844348 TTACGGAGATAGAGAGCAGAAGG + Intergenic
1028147557 7:87335035-87335057 TTATGGAGATAGAAAGTAGAAGG - Intergenic
1028299090 7:89174275-89174297 TCAGGGAGATGGAGAGTAGAAGG - Intronic
1028354065 7:89885365-89885387 ATATGGAGATAGAGAGTAGAAGG - Intergenic
1028895669 7:96039173-96039195 TTATGGAGATGCAGAGTTGAGGG + Intronic
1029169231 7:98618624-98618646 TTTCAGAGATAGAGATGAGACGG - Intronic
1030042065 7:105460441-105460463 TAAGAGAGATGGAGAAGAGAAGG + Intronic
1030693940 7:112563612-112563634 TTATGGACATAGAGAGTAGAAGG - Intergenic
1030733929 7:113021515-113021537 TCATAGACATAGAGAGCAGAAGG - Intergenic
1030844821 7:114396195-114396217 TCATGGAGATAGAGAGTAGAGGG - Intronic
1031107369 7:117561506-117561528 TTATAGAGACAGAAAGTAGATGG - Intronic
1031123207 7:117744361-117744383 TCATGGAGATAGAGAGTAGAAGG - Intronic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031903971 7:127440579-127440601 TGATAGGTGTGGAGAGGAGAAGG - Intergenic
1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG + Intergenic
1032426091 7:131823151-131823173 TAATAGAGATCAAGAGGAGCAGG - Intergenic
1032941260 7:136795370-136795392 TCATAGAGATACAGAGTAGAAGG + Intergenic
1033415623 7:141158938-141158960 AATTAGAGATGGAGAGGACAAGG + Intronic
1033833262 7:145278134-145278156 TCATAGAGATAGATAGTAGAAGG - Intergenic
1034177211 7:149109546-149109568 CTATAGGGATTTAGAGGAGAAGG - Intronic
1035506567 8:141130-141152 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035751158 8:1997349-1997371 TAAAATAGATGGAGAGGAGTTGG - Intronic
1035914128 8:3600228-3600250 TTATACTAATGGGGAGGAGAAGG - Intronic
1035927121 8:3740524-3740546 ATATACAGACGGAAAGGAGAAGG + Intronic
1037072550 8:14669508-14669530 TCATAGAAATAGAGAGTAGAAGG - Intronic
1037208606 8:16356992-16357014 TTATGGACATAGAGAGTAGAAGG - Intronic
1037543937 8:19899373-19899395 TTATGGTGATGGAGAAGAGGAGG + Intergenic
1037668130 8:20989494-20989516 TTACAGAGATAGAGAGCAGAAGG - Intergenic
1037672387 8:21026323-21026345 TCTTAGAGATGGAGAGAAAATGG - Intergenic
1037698868 8:21253708-21253730 TGAGGGAGATGGAGAGGAGAGGG - Intergenic
1038007392 8:23444359-23444381 TGATGATGATGGAGAGGAGAAGG + Intronic
1038324350 8:26561325-26561347 AGGTAAAGATGGAGAGGAGAGGG - Intronic
1038529034 8:28302137-28302159 TCATGGACATGGAGAGTAGAAGG - Intergenic
1039236446 8:35507563-35507585 TCATGGAGATAGAGAGCAGAAGG + Intronic
1039610664 8:38916445-38916467 TCATGGAGATAGAGAGTAGAAGG - Intronic
1039656954 8:39420666-39420688 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1039745985 8:40427780-40427802 GAATAGAGATAGAGAGGAGGTGG - Intergenic
1040577292 8:48664923-48664945 TGGCAGAGCTGGAGAGGAGAGGG - Intergenic
1040867317 8:52061374-52061396 TCATGGACATGGAGAGTAGAAGG - Intergenic
1041342294 8:56858651-56858673 GTAAGGAAATGGAGAGGAGAGGG - Intergenic
1041387171 8:57316991-57317013 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042450054 8:68933683-68933705 TTTTTGAGATGTAGAGGAGAGGG - Intergenic
1042840495 8:73118607-73118629 TTCTAGCTCTGGAGAGGAGATGG - Intronic
1042933781 8:74038373-74038395 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1042955020 8:74240438-74240460 TCATGGAGATGGAGAGTAGAAGG - Intronic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1043615915 8:82125139-82125161 TTCTAGAGATGAAGGGGATATGG - Intergenic
1043871499 8:85438595-85438617 TGAGAGAGAAGAAGAGGAGATGG + Intronic
1043959304 8:86397579-86397601 TTAGAGAAATGGAGAGATGAAGG - Intronic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044394658 8:91696548-91696570 TCATGGACATGGAGAGTAGAAGG - Intergenic
1044487820 8:92773028-92773050 TCATAGAGGTAGAGAGTAGAAGG - Intergenic
1044683273 8:94802796-94802818 TTTTAGAGATGGCGGGGGGAGGG + Intergenic
1044683821 8:94808028-94808050 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1045432939 8:102130405-102130427 TCATAGAAGTGGAGAGTAGATGG + Intergenic
1046062683 8:109157978-109158000 TTCTACAGATGGTGAGGGGATGG + Intergenic
1046113684 8:109758976-109758998 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1046150491 8:110217970-110217992 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1046273782 8:111930315-111930337 TAATAAGGATGGAGAAGAGAAGG + Intergenic
1046773792 8:118142440-118142462 TGGTAGGGATGGACAGGAGAAGG - Intergenic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1048105805 8:131407856-131407878 TTATGGACATAGAGAGAAGAAGG - Intergenic
1048466083 8:134665742-134665764 AGAGAGAGATGGACAGGAGAAGG + Intronic
1049078510 8:140420914-140420936 TTAAACACATGGAGAGGAAAAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050137764 9:2485455-2485477 TCATGGAGATGGAGAATAGAAGG + Intergenic
1050259285 9:3824233-3824255 TTATAGATATGAGGAGGAAATGG - Intronic
1050352319 9:4752138-4752160 TTCTAAAGATGGAGAAGGGAAGG + Intergenic
1050392761 9:5163579-5163601 TCATACAGATGGAAAGCAGAAGG + Intronic
1050948968 9:11563665-11563687 TCACAGAGATAGAGAGTAGAAGG - Intergenic
1051219861 9:14836913-14836935 TTATGCAGATAGAGAGGAAAAGG + Intronic
1051729642 9:20127085-20127107 TTAAAGACATGAAGAGAAGAGGG - Intergenic
1051806377 9:20997185-20997207 GTATATAGATGGGAAGGAGAGGG - Intergenic
1051990639 9:23147808-23147830 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1052208564 9:25872672-25872694 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1052367696 9:27631591-27631613 TTACTGAGATGGAGAAGACAAGG + Intergenic
1052420127 9:28233627-28233649 TGCTGGAGTTGGAGAGGAGATGG - Intronic
1052677248 9:31643089-31643111 TTTTAGAGACAGATAGGAGAGGG - Intergenic
1053164144 9:35832888-35832910 TGATAGAGATGCAGCCGAGAGGG - Intronic
1053205446 9:36182538-36182560 TCATGGAGATAGACAGGAGAAGG + Intergenic
1053455383 9:38229571-38229593 TTATACAGATGAAGAGGCGGAGG + Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055320496 9:75079594-75079616 TCTGAGATATGGAGAGGAGAGGG + Intronic
1055381328 9:75710109-75710131 TCAGAGAGAGAGAGAGGAGAGGG - Intergenic
1055387629 9:75780457-75780479 TTACAGAGATAGAGAGTAGAAGG + Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1056769247 9:89464971-89464993 TTATAGCTATAGAGAGGACATGG - Intronic
1057082306 9:92181936-92181958 AGAAAGACATGGAGAGGAGAGGG - Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1057822625 9:98344143-98344165 TCAGAGCGATGGAGAAGAGAAGG - Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059166925 9:112086134-112086156 TTGTAGAGATGGTGGTGAGAGGG - Intronic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059220692 9:112615119-112615141 TTATAAAAATGAAGAGGAGGAGG + Intronic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059540528 9:115125904-115125926 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1059651589 9:116320581-116320603 TTAAAGAGATAGAGGGGAAAGGG - Intronic
1059900076 9:118914522-118914544 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1060122887 9:121011937-121011959 TTATGGAGATATAGAGTAGAAGG + Intronic
1060352305 9:122869420-122869442 TTAAAGAGAAGGAGAAGAGAAGG - Intronic
1061628028 9:131853554-131853576 TTACAGAGATGGTGAACAGATGG + Intergenic
1062165385 9:135104991-135105013 AGAAAGGGATGGAGAGGAGATGG - Intronic
1062740319 9:138170041-138170063 TCATAGAGATAGAGAGTATAAGG + Intergenic
1203369964 Un_KI270442v1:293946-293968 TCATAGAGATAGAGAGTATAAGG - Intergenic
1203553021 Un_KI270743v1:180108-180130 GTATAGAGAGGGAGAGAAGTAGG + Intergenic
1203601741 Un_KI270748v1:16200-16222 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1185939763 X:4303212-4303234 TCATAGACATAGAGAGTAGAAGG - Intergenic
1185951316 X:4437612-4437634 TTTTAGAAATGGATAGGAGATGG + Intergenic
1186276521 X:7944875-7944897 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1186310041 X:8308027-8308049 TGATAGACATAGAGAGTAGAAGG + Intergenic
1186329375 X:8515881-8515903 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1186692136 X:11989443-11989465 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1186761797 X:12730904-12730926 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1187095673 X:16145456-16145478 TCATGGACATGGAGAGTAGAAGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187578893 X:20587492-20587514 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1187715903 X:22102251-22102273 TCATAGAGATAGAGAATAGAAGG - Intronic
1187846800 X:23547115-23547137 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1187849420 X:23576828-23576850 TCATGGAGATAGAGAGTAGATGG - Intergenic
1188323267 X:28766719-28766741 TCATGGACATGGAGAGTAGAAGG - Intronic
1188424680 X:30032617-30032639 TGAGAGAGATCAAGAGGAGATGG + Intergenic
1188465349 X:30473331-30473353 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1188728643 X:33617331-33617353 TCATAGACATAGAGAGAAGAAGG + Intergenic
1188741553 X:33789454-33789476 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1188998646 X:36917899-36917921 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189012936 X:37064572-37064594 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189482759 X:41405855-41405877 TTACAGGGATAGAGAAGAGATGG + Intergenic
1189690002 X:43606720-43606742 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189854041 X:45205209-45205231 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1190139556 X:47830773-47830795 TTACGGAGATAGAGAGTAGAAGG + Intergenic
1190194017 X:48301593-48301615 TGATAGATATGGGGAGAAGAAGG + Intergenic
1190199900 X:48351980-48352002 TGATAGACATGGGGAGAAGAAGG + Intronic
1190666679 X:52702461-52702483 TGATAGACATGGGGAGAAGAAGG + Intronic
1190672739 X:52755947-52755969 TGATAGACATGGGGAGAAGAAGG - Intronic
1190853140 X:54266255-54266277 TCATAGAGATAGAAAGTAGAAGG + Intronic
1191189025 X:57646153-57646175 TCATGGAGATAGAGAGCAGAGGG + Intergenic
1191676394 X:63796174-63796196 TTATGGGTATGGAGAGGAGGGGG - Intergenic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1191741893 X:64445150-64445172 GTAGAGGGATGGAGAGGAGAGGG - Intergenic
1191781916 X:64878396-64878418 TCATGGAGATAGAGAGTAGAGGG + Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1192068091 X:67907934-67907956 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1192204346 X:69086241-69086263 TTTTATAGATGGAGAGGATGAGG - Intergenic
1192463602 X:71339246-71339268 ATATAGAGAAGGAAAGAAGAAGG - Intergenic
1192503943 X:71669732-71669754 TGATAGGGGTGGAGGGGAGAGGG + Intergenic
1192510037 X:71716156-71716178 TGATAGGGGTGGAGGGGAGAGGG - Intronic
1192516660 X:71765397-71765419 TGATAGGGGTGGAGGGGAGAGGG + Intronic
1192529168 X:71871279-71871301 TGATAGGGGTGGAGGGGAGAGGG - Intergenic
1192635147 X:72808712-72808734 TGAGAGAGAGGGAGAGGTGAAGG + Intronic
1192646568 X:72912091-72912113 TGAGAGAGAGGGAGAGGTGAAGG - Intronic
1192689309 X:73344971-73344993 TTATAGAAACAGAGAGGATAAGG + Intergenic
1192852630 X:74973627-74973649 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193055120 X:77141844-77141866 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193245699 X:79226172-79226194 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193292993 X:79799423-79799445 TTATAGACACAGAGAGTAGAAGG - Intergenic
1193439265 X:81518452-81518474 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1193659977 X:84245585-84245607 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193842392 X:86422848-86422870 TCATGGAGATGGAGAGTAGAAGG - Intronic
1194079567 X:89443118-89443140 TCATAGAGATAAAGAGTAGAAGG - Intergenic
1194167187 X:90532191-90532213 TCATAGATATAGAGAGTAGAAGG + Intergenic
1194329644 X:92565597-92565619 TTATAGAGATAGAGAGTAAAAGG + Intronic
1194374156 X:93111717-93111739 TTATAGACAGAGAGAGTAGAAGG - Intergenic
1194379125 X:93173219-93173241 TCATAGACATTGAGAGTAGAAGG + Intergenic
1194529051 X:95021531-95021553 TCATAGAAACGGAGAGTAGAAGG + Intergenic
1194992376 X:100558454-100558476 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1195051367 X:101099723-101099745 TGATAGAAATGAAGTGGAGATGG - Intronic
1195279767 X:103320052-103320074 TCATAGAGATAGAGAGTAGAAGG - Intergenic
1195781937 X:108476611-108476633 TCATGGAGATAGAGAGTAGAAGG - Intronic
1195824476 X:108983011-108983033 TCATGGAGATAGAGAGTAGATGG - Intergenic
1195911611 X:109893821-109893843 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1195997842 X:110749096-110749118 ATATTGAGAAGGAGAGGACAAGG - Intronic
1196056369 X:111360405-111360427 TCATGGAGATAGAGAGTAGAAGG + Intronic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196254546 X:113500870-113500892 TTATGGATATAGAGAGTAGAAGG - Intergenic
1196316108 X:114226021-114226043 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1196332499 X:114488890-114488912 TCATAGACATAGAGAGAAGAAGG - Intergenic
1196385655 X:115146239-115146261 TCATAAAGATAGAGAGTAGAAGG + Intronic
1196407699 X:115382397-115382419 CCATAGAGATAGAGAGTAGAAGG + Intergenic
1196605249 X:117650278-117650300 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1196729198 X:118924072-118924094 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1196752148 X:119127671-119127693 TTAAAGAGATGCAGAGGAATGGG - Intronic
1196771181 X:119295503-119295525 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1196886743 X:120252716-120252738 TTGTAAAGATGGAGAGATGAGGG + Intronic
1196942720 X:120793326-120793348 TTATAGAAGTGAAGAAGAGAAGG - Intergenic
1197019422 X:121668822-121668844 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1197309825 X:124891107-124891129 TTACGGAGATAGAGAGTAGAAGG + Intronic
1197408916 X:126091921-126091943 TCATGGAAATGGAGAGTAGAAGG + Intergenic
1197435109 X:126418269-126418291 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197468924 X:126842383-126842405 TGATGGATATGGAGAGTAGAAGG + Intergenic
1197487285 X:127068748-127068770 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1197600743 X:128525514-128525536 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1197915881 X:131534570-131534592 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198111811 X:133508886-133508908 TTATGCAGAAGGAAAGGAGATGG - Intergenic
1198305909 X:135382943-135382965 TTGTAGTGATGGAGTGGAGTGGG - Intergenic
1198316013 X:135467201-135467223 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1198342784 X:135731467-135731489 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1198345205 X:135751828-135751850 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198454260 X:136800374-136800396 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198538327 X:137608962-137608984 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198546260 X:137695740-137695762 TTATAGAGAAGGAGGGCAGAGGG - Intergenic
1198549373 X:137728624-137728646 TCACAGAGATAGAGAGTAGAAGG + Intergenic
1198734105 X:139767391-139767413 ATATATAGAGGGAGAGGAGAAGG + Intronic
1198784928 X:140276798-140276820 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1199047825 X:143197679-143197701 TTATGGACATAGAGAGTAGAAGG - Intergenic
1199099230 X:143779471-143779493 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199140982 X:144312043-144312065 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1199194445 X:145010841-145010863 TTATGAAGATAGAGAGTAGAAGG + Intergenic
1199195421 X:145023807-145023829 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199219316 X:145298833-145298855 TCATGGAGATAGAGAGGAGAAGG + Intergenic
1199222371 X:145332355-145332377 TTATAGAAGTAGAGAGTAGAAGG - Intergenic
1199248578 X:145633988-145634010 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1199259406 X:145753563-145753585 TGCTAGTGATGGAGAGGACATGG + Intergenic
1199276794 X:145953624-145953646 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1199366691 X:146994589-146994611 TCATAGACATAGAGAGTAGAAGG + Intergenic
1199370031 X:147036433-147036455 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1199442692 X:147886356-147886378 TTATGGACATAGAGAGTAGAAGG - Intergenic
1199512164 X:148634597-148634619 TTTGAGAGAGGGAGAGAAGAGGG - Intronic
1199849594 X:151715887-151715909 TTACAGAGTAGCAGAGGAGAAGG + Intergenic
1200106067 X:153713389-153713411 TTCTATAGATGGAGTGTAGATGG - Intronic
1200364963 X:155652430-155652452 TCATGGAGATAGAGAGTAGAAGG - Intronic
1200432187 Y:3098425-3098447 TCATAGAGATAAAGAGTAGAAGG - Intergenic
1200513451 Y:4109967-4109989 TCATAGATATAGAGAGTAGAAGG + Intergenic
1200638346 Y:5684789-5684811 TTATAGAGATAGAGAGTAAAAGG + Intronic
1201690482 Y:16759320-16759342 TTCTGTAGGTGGAGAGGAGAAGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1201723079 Y:17123796-17123818 TCATAGACATAGAGAGTAGAAGG - Intergenic
1201760099 Y:17527476-17527498 TCATAGAGATAGAGAGTATAAGG - Intergenic
1201841455 Y:18378514-18378536 TCATAGAGATAGAGAGTATAAGG + Intergenic