ID: 1064839271

View in Genome Browser
Species Human (GRCh38)
Location 10:19572685-19572707
Sequence AACGGCATTTTGAAGTACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064839268_1064839271 6 Left 1064839268 10:19572656-19572678 CCTTTGTAGATGTAATTAAGATG 0: 1
1: 1
2: 8
3: 57
4: 478
Right 1064839271 10:19572685-19572707 AACGGCATTTTGAAGTACGGTGG No data
1064839267_1064839271 22 Left 1064839267 10:19572640-19572662 CCATTTAGAAATAGGGCCTTTGT 0: 1
1: 1
2: 4
3: 10
4: 205
Right 1064839271 10:19572685-19572707 AACGGCATTTTGAAGTACGGTGG No data
1064839266_1064839271 23 Left 1064839266 10:19572639-19572661 CCCATTTAGAAATAGGGCCTTTG 0: 1
1: 4
2: 29
3: 78
4: 301
Right 1064839271 10:19572685-19572707 AACGGCATTTTGAAGTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064839271 Original CRISPR AACGGCATTTTGAAGTACGG TGG Intronic
No off target data available for this crispr