ID: 1064842284

View in Genome Browser
Species Human (GRCh38)
Location 10:19607136-19607158
Sequence GACACTGATCTGACTTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064842284 Original CRISPR GACACTGATCTGACTTCAAT AGG (reversed) Intronic
900823487 1:4908241-4908263 GACAGTGATCAGACTTTAAATGG + Intergenic
908201071 1:61796349-61796371 CACACTGATCTCCCTCCAATAGG - Intronic
909771940 1:79434816-79434838 GACACTGAACTGAAATAAATGGG - Intergenic
912247068 1:107970437-107970459 GAAACTGATTTATCTTCAATAGG - Intergenic
912700500 1:111874934-111874956 GCCACTGATCAGCCTGCAATAGG + Intronic
914336016 1:146715527-146715549 TACACTGCGCAGACTTCAATGGG + Intergenic
919594956 1:199549690-199549712 GAAACTGATGTCACTTCAATTGG + Intergenic
919951387 1:202367501-202367523 GACACTAATGTGACTGGAATGGG - Intronic
921153989 1:212424205-212424227 TACACTGATCCCACTTCAAAAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923956148 1:239023922-239023944 GACAGAGAACTGAGTTCAATGGG + Intergenic
1063591207 10:7397252-7397274 CAAACTGATCTGCCTTCAAGAGG + Intronic
1064842284 10:19607136-19607158 GACACTGATCTGACTTCAATAGG - Intronic
1069124411 10:64611954-64611976 GACAATGATATGAAGTCAATTGG + Intergenic
1077241757 11:1514225-1514247 GACACAGATCAGACATGAATGGG + Intergenic
1079562744 11:21843238-21843260 GACACTGAACTGACTAAAATTGG - Intergenic
1083362351 11:62119333-62119355 GACCCCTATCTCACTTCAATGGG - Intergenic
1097208021 12:57340271-57340293 GAGACTGCTCTGACGTCACTGGG - Intronic
1098523356 12:71459021-71459043 GCCACTGCTCAGACTTAAATGGG - Intronic
1099157642 12:79199191-79199213 GACACTGAATTGAATTGAATTGG - Intronic
1100577351 12:95905910-95905932 CACACTGTTCTGACATGAATAGG + Intronic
1107826757 13:44335555-44335577 GGCACTGATCTGATTTTGATTGG - Intergenic
1111326406 13:86702291-86702313 AACACTGATATGACTTCATGGGG - Intergenic
1112847576 13:103663151-103663173 GACACTGAACTGGATTCAGTGGG - Intergenic
1113657994 13:112081894-112081916 TACAGGGTTCTGACTTCAATAGG - Intergenic
1114588417 14:23836298-23836320 GACACTCTACTAACTTCAATAGG - Intergenic
1117025157 14:51611605-51611627 GACACAGATTTGAATTCAGTAGG + Intronic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1119874648 14:78048009-78048031 GAAACTGATCTGCCTGCAAAGGG - Intergenic
1120635119 14:86941498-86941520 GACACTGAACTAACCTCAAGTGG - Intergenic
1125106774 15:35980566-35980588 GACACAAATCTGACTTCCCTAGG - Intergenic
1126213121 15:46122334-46122356 GATACTGATCTTACTTCATTTGG + Intergenic
1128227754 15:66014020-66014042 GACTGTGATCTGATTACAATGGG + Intronic
1139997606 16:70995692-70995714 TACACTGCGCAGACTTCAATGGG - Intronic
1141048284 16:80737073-80737095 GAAACTGATCTGCCTGCAAAGGG - Intronic
1151591014 17:75044740-75044762 GACCCTGATCTTACTTAAAGAGG - Intronic
1155081176 18:22411370-22411392 AACACTAATCTCACTTCAAAGGG - Intergenic
1156954986 18:42951654-42951676 GATACTGATTTCAATTCAATTGG - Intronic
1157739761 18:50082033-50082055 GGCACTGAACTGACTTTTATGGG - Intronic
1157981927 18:52391697-52391719 GACACTGGTCAAACTTTAATAGG + Intronic
1158710743 18:59835868-59835890 CACAGTGATCTGCCTTCCATGGG + Intergenic
1159510500 18:69392564-69392586 TAAACTCATCTGAATTCAATGGG - Intergenic
1159678531 18:71317526-71317548 AACCCTGATCTGACCTCAATCGG + Intergenic
929680229 2:43986757-43986779 GAAACTAATCTGGCTGCAATTGG + Intronic
936046555 2:109192759-109192781 GTCACTGCTGTGACTTCCATGGG - Intronic
936533286 2:113291539-113291561 GACACTGGACTGAGTTCCATGGG + Intergenic
937487634 2:122332278-122332300 GAGACACATCTGACTTCATTTGG + Intergenic
940592667 2:155748980-155749002 GGCACTGATCTGATGCCAATAGG - Intergenic
941755466 2:169181150-169181172 CACACTGAGCTGACTACCATGGG + Intronic
946715327 2:222548681-222548703 GACATTGATGTGCTTTCAATAGG + Intronic
1169061130 20:2661015-2661037 GACACTGGTCTGAGTTCCCTTGG - Intronic
1170015197 20:11772758-11772780 GACACAGATCTTACTTTAAAAGG + Intergenic
1175860878 20:62149388-62149410 GACACTGGTCTGATTCTAATCGG + Intronic
1177299368 21:19221533-19221555 GAGACTGATCAGACTGTAATGGG - Intergenic
1178375136 21:32060351-32060373 GACACTGATCTGGCTGGAAATGG + Intergenic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1181698261 22:24604887-24604909 GAGACAGAGCTGCCTTCAATGGG - Intronic
949382255 3:3459599-3459621 CACAGTGATCTGACCTCAGTGGG - Intergenic
949655851 3:6218241-6218263 TACACTGAACTGTCTTCAGTAGG + Intergenic
949755131 3:7400499-7400521 TAGACTGATTTGACTACAATGGG - Intronic
955548761 3:60059879-60059901 GACAATGGTTTGACTTCAACAGG + Intronic
957525420 3:81373233-81373255 GAAAATGATTTGCCTTCAATAGG + Intergenic
959468304 3:106717719-106717741 GATACTGATTTGGCTGCAATAGG + Intergenic
964019720 3:151994869-151994891 GTCACTGATCTGCCTACAATGGG + Intergenic
970656884 4:18241161-18241183 GAGCCTGATCTGACTCCAAGAGG + Intergenic
973991806 4:56416465-56416487 GAAACTGATCTAATTTCAAACGG + Intronic
976389835 4:84496930-84496952 GACGCTGGACTGTCTTCAATGGG + Intronic
976544892 4:86323278-86323300 GACACAGATCTTGCTTCAAATGG - Intronic
982528846 4:156512114-156512136 GACAGAAATCTGACTCCAATTGG + Intergenic
983034936 4:162852127-162852149 AACACTGATGTAACTTCATTAGG - Intergenic
983941366 4:173537631-173537653 GAAACTAATCTGATTGCAATTGG - Intergenic
984142797 4:176023793-176023815 GGCACTTATTTGACTTCGATTGG + Intergenic
984601111 4:181728015-181728037 CAGACTGATCTGATTTCAGTGGG - Intergenic
986439756 5:7769912-7769934 GATACTGAACCGACTTCTATTGG - Intronic
986569636 5:9151874-9151896 GACACTGGTGTGTCTTCACTGGG - Intronic
986839356 5:11678527-11678549 GACAATCATCAGCCTTCAATAGG + Intronic
989519589 5:42384932-42384954 AACACTTAGCTGACTTTAATGGG + Intergenic
993545640 5:89209241-89209263 GAAACTGATCTTATTTCAATGGG - Intergenic
995987689 5:118199602-118199624 GATACTGATCTCACATCCATAGG + Intergenic
996180684 5:120416050-120416072 GCCACTGAGAGGACTTCAATAGG + Intergenic
999938369 5:156513526-156513548 GACACTGATCTCTTTTCAATAGG - Intronic
1004489567 6:16101303-16101325 GGCACTGCTCTGATTTCAACGGG - Intergenic
1012775657 6:103490936-103490958 AACACTAATCTGACTTGCATGGG - Intergenic
1016186991 6:141209402-141209424 GACAATGCTCAGACTTCAAATGG - Intergenic
1018973650 6:168546880-168546902 GACACTGACCTAACTTCACGTGG - Intronic
1019010000 6:168837239-168837261 GACACTGATCTAAAAACAATAGG + Intergenic
1026113098 7:67473976-67473998 GACAGTGAGCTGACTCCAAAGGG - Intergenic
1032207682 7:129882470-129882492 GACACAGAACTGACTGCAAGAGG + Intronic
1034187948 7:149193867-149193889 GACACTGACCTGCCTTTAAAGGG + Intergenic
1038382721 8:27112138-27112160 GACAATGATGTGAGTTCAACAGG + Intergenic
1040605110 8:48923870-48923892 GTCATTGATTTGACTTCTATTGG - Intergenic
1043039059 8:75237103-75237125 GATAATGATATGACTTCACTGGG + Intergenic
1046023080 8:108689759-108689781 TAAGCTGATCTGACTTCATTAGG - Intronic
1047373797 8:124277414-124277436 GGCAATCATCTGACTTCAATTGG + Intergenic
1050304231 9:4291264-4291286 GACACTAATTTGTCTTCAGTTGG - Intronic
1052965044 9:34333872-34333894 GACACTGATATTATTTCAAAAGG - Intronic
1055223001 9:73960786-73960808 GAGAGTGGTCTGACTCCAATGGG - Intergenic
1186074107 X:5857851-5857873 GACCTTTATCTGACTTCTATTGG - Intronic
1198244214 X:134813847-134813869 GACACTGACCTGTCTTCAGTGGG + Intronic
1199328378 X:146529001-146529023 GACACTGATTTTATTTCATTTGG + Intergenic
1201330159 Y:12810108-12810130 AACACTGATCTATCTTTAATAGG - Intronic