ID: 1064843863

View in Genome Browser
Species Human (GRCh38)
Location 10:19629120-19629142
Sequence GAGGCTTGCTTTTTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064843863_1064843869 9 Left 1064843863 10:19629120-19629142 CCCCTTCCCAAAAAGCAAGCCTC 0: 1
1: 0
2: 0
3: 18
4: 239
Right 1064843869 10:19629152-19629174 TTGTACACTTAGCTATTAAATGG No data
1064843863_1064843870 17 Left 1064843863 10:19629120-19629142 CCCCTTCCCAAAAAGCAAGCCTC 0: 1
1: 0
2: 0
3: 18
4: 239
Right 1064843870 10:19629160-19629182 TTAGCTATTAAATGGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064843863 Original CRISPR GAGGCTTGCTTTTTGGGAAG GGG (reversed) Intronic
900575974 1:3382629-3382651 GAGTCCTGCCTCTTGGGAAGTGG + Intronic
900650770 1:3729150-3729172 TAGACCTGCTTCTTGGGAAGAGG + Intronic
902109352 1:14064993-14065015 GAGGCTGGGTTTTGGGGAACAGG + Intergenic
902928457 1:19713448-19713470 GTGGCTGGCTTTTGGGGATGTGG + Intronic
903142816 1:21349611-21349633 GAGGCTTGAGTATTTGGAAGGGG - Intergenic
904868777 1:33603249-33603271 GAGTATTGCTTTTGGGGAACAGG - Intronic
905174667 1:36127938-36127960 GGGGCATGCTTTGTGGGAAAGGG + Intergenic
905204030 1:36332668-36332690 GAGATCTGCTTTTTGGGAGGAGG - Intergenic
906477900 1:46182120-46182142 GGGGCCTGGTTTGTGGGAAGGGG + Intronic
906731540 1:48085896-48085918 GAGGCTTTCTAAGTGGGAAGTGG - Intergenic
907049930 1:51323139-51323161 GAGTGTTGCTTATTGGGTAGAGG - Intronic
910792322 1:91064303-91064325 GAGGTGTGTTTTTTGGTAAGTGG + Intergenic
914424571 1:147563276-147563298 GGGGCTTACTTTTGGTGAAGAGG - Intronic
915504212 1:156342571-156342593 CAGGCTTGTTTTTTATGAAGAGG + Intronic
915619273 1:157069922-157069944 GAGACTGCCTTTTTGAGAAGTGG + Intergenic
916940465 1:169671601-169671623 GAGGCTACCTTTGTGGGGAGGGG + Intronic
917521093 1:175749026-175749048 GGGGCTTCTTTTCTGGGAAGTGG + Intergenic
917815802 1:178708777-178708799 CAGGCATGCTTTTTGGTAAATGG - Intergenic
918026053 1:180747811-180747833 GAGGCATGCTTCATGGGAATTGG - Intronic
918187088 1:182137645-182137667 GAGGCTTGTTGGATGGGAAGAGG - Intergenic
922146139 1:222946765-222946787 GAGGCTTGTCTTTTAGGCAGAGG + Intronic
923149353 1:231219601-231219623 GAGTTTTGCTTTCTAGGAAGTGG - Intronic
923811856 1:237326908-237326930 GCTGCTTTATTTTTGGGAAGTGG + Intronic
1062919405 10:1267989-1268011 GAGGCTGGCTAGTGGGGAAGGGG + Intronic
1064300021 10:14115043-14115065 GAGGCTTGCTTGGTGGGTGGGGG - Intronic
1064385917 10:14891349-14891371 GTGGCTTGCTTTCTGAAAAGAGG + Intronic
1064843863 10:19629120-19629142 GAGGCTTGCTTTTTGGGAAGGGG - Intronic
1064932532 10:20643054-20643076 GACTCTTGCTTTTTGGGTCGGGG - Intergenic
1069851211 10:71406289-71406311 GAGGCTTTCCTCTGGGGAAGAGG + Intronic
1070207326 10:74276720-74276742 CTTGCTGGCTTTTTGGGAAGTGG + Intronic
1075925672 10:126250063-126250085 GAGTCTTGCTTTGGTGGAAGGGG - Intronic
1078360312 11:10662847-10662869 GAGGCCTGCTTCATGGGAATGGG - Intronic
1079572787 11:21965336-21965358 GATGCATTCTTTTTTGGAAGGGG + Intergenic
1080038198 11:27731243-27731265 GAGGGCTGCTTGTTTGGAAGGGG - Intergenic
1080562885 11:33480198-33480220 CAGGGTTTCTTTTGGGGAAGAGG - Intergenic
1081018985 11:37919603-37919625 AAGGCTTGCTTTGTGGGAGAGGG - Intergenic
1081467560 11:43336510-43336532 GAGGATTGCATTCTGGGCAGAGG - Intronic
1084042510 11:66550422-66550444 GAGGCTGACTTTTGGGGAAGGGG + Intronic
1084618489 11:70252232-70252254 GAGGCCTGTTTCTTGGGCAGTGG - Intergenic
1084689754 11:70718282-70718304 GAGCCCTGCTTTCTGTGAAGGGG + Intronic
1085014735 11:73166380-73166402 GAGTCTTGCTCTTTGGCGAGGGG + Intergenic
1086696663 11:89855176-89855198 GAGGCTGGCTTTTCTGGCAGTGG - Intergenic
1086709495 11:89989314-89989336 GAGGCTGGCTTTTCTGGCAGTGG + Intergenic
1086795649 11:91098289-91098311 GGGGCTTCCATGTTGGGAAGAGG - Intergenic
1087149167 11:94843086-94843108 GAGGCTTGTTATTTGGGGAAAGG - Intronic
1088412578 11:109551560-109551582 GTGGCCTGCTTTTTTAGAAGAGG + Intergenic
1088467130 11:110152965-110152987 GTGGATTGGTTTTTGGAAAGAGG + Exonic
1090082904 11:123626327-123626349 GAGGAATGCTTTGTGAGAAGTGG + Intronic
1090172668 11:124618469-124618491 GAGACTGGCTTGTGGGGAAGGGG - Intronic
1091445309 12:541691-541713 GAGGCTGGCAGTGTGGGAAGAGG - Intronic
1091657614 12:2356977-2356999 GAGGCTGCATTTTTGAGAAGTGG - Intronic
1091797702 12:3306626-3306648 GAGGCTTCATTTTAGGGATGTGG + Intergenic
1092728365 12:11506210-11506232 GGTGCTTTCTTCTTGGGAAGTGG - Intergenic
1092986387 12:13849965-13849987 GAGGCTTGCTTATCTGCAAGAGG - Intronic
1093064896 12:14647042-14647064 GAGGCAAGAGTTTTGGGAAGAGG + Intronic
1093381210 12:18495991-18496013 AAGGTTTGCTTTTTGGGGATTGG + Intronic
1101723746 12:107373050-107373072 GAGGCATTCTTTTTGAGGAGAGG - Intronic
1101846594 12:108367900-108367922 GAGGCCTGCATGTTGGTAAGGGG - Intergenic
1103317689 12:120069833-120069855 GAGGTTTGCTTTTGAGGAAGCGG - Intronic
1104133932 12:125919643-125919665 GGGGGTTGCTCTATGGGAAGGGG + Intergenic
1106163840 13:27224501-27224523 CAGGATTGCTTTTTGGGGCGGGG - Intergenic
1106177691 13:27345231-27345253 GATGCTTTCTTTTTGAGATGAGG + Intergenic
1108303720 13:49108692-49108714 GAGGCTTGCTTTTTGTTTAGGGG + Intronic
1108585295 13:51865624-51865646 GATCCTGGGTTTTTGGGAAGAGG + Exonic
1108687476 13:52833285-52833307 GTGGCTGGCATTTTGGAAAGGGG - Intergenic
1110392775 13:74994467-74994489 GAGGCTTGATTTCAAGGAAGAGG - Intergenic
1110619731 13:77581892-77581914 GAGGCTTGCATTGTGTGGAGGGG + Intronic
1115565087 14:34618346-34618368 GTGGCCTCCTTTTTGGGGAGGGG + Intronic
1119342807 14:73894830-73894852 GAGGGTTGCTTTATGCTAAGGGG + Intronic
1119748042 14:77058502-77058524 GAAGCCTGCTTTCTGGCAAGGGG + Intergenic
1119778153 14:77260801-77260823 CAGGCTTGGTTTCTGGGCAGAGG - Intergenic
1120302274 14:82723200-82723222 GACTCTTTCTTGTTGGGAAGTGG + Intergenic
1121206635 14:92174355-92174377 GAAGCTTGCTCTTGGGGCAGGGG + Intergenic
1121692135 14:95885569-95885591 GAGGCCTGTTTATTGGGGAGAGG + Intergenic
1123945009 15:25234752-25234774 GAGGGTGGGTTTTTGGGAATTGG + Intergenic
1125265486 15:37875157-37875179 GAGATTTGCTTTTTGGGGTGGGG + Intergenic
1126489657 15:49222891-49222913 GATGCTTGCCTTTTGGGACTAGG + Intronic
1127039811 15:54962259-54962281 GAGGCTTTCTTTTAAGGAAAAGG + Intergenic
1129122566 15:73409933-73409955 GTGTCTTGCTTTGTGGGATGAGG + Intergenic
1129716182 15:77852454-77852476 GAGGCTTCCGCTTTGGGCAGTGG - Intergenic
1129881018 15:79006010-79006032 GAGGCTTGGTTCCTGGGGAGAGG + Intronic
1131529729 15:93180955-93180977 CAGGCTTGCTTTATGGGCAGAGG + Intergenic
1132342768 15:101088638-101088660 GAGGATTGGTTTTTGGGAGAGGG - Intergenic
1134834759 16:17351736-17351758 GAGGCTTTTTTTTTGGGGGGGGG + Intronic
1136459325 16:30399881-30399903 GAGGCCAGCTGTTTGGGAAAAGG + Exonic
1137519316 16:49178603-49178625 GAGGCTGACTCTTTGGGAAAGGG - Intergenic
1137848032 16:51710978-51711000 GATGTTTGCTTTTTGGAAGGTGG - Intergenic
1137931051 16:52588119-52588141 GAGGAGTCCTTTTGGGGAAGAGG - Intergenic
1138207050 16:55132870-55132892 GAGGCTTGCTCAGTGGGAGGGGG + Intergenic
1138277912 16:55749681-55749703 GGGGCATGCCTATTGGGAAGGGG + Intergenic
1138283906 16:55793528-55793550 GGGGCATGCCTATTGGGAAGGGG + Intergenic
1138285096 16:55803459-55803481 GGGGCATGCCTATTGGGAAGGGG - Intronic
1138519281 16:57561780-57561802 AAAGACTGCTTTTTGGGAAGGGG + Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139596917 16:67963613-67963635 GGGACTGGCTTTCTGGGAAGGGG - Intronic
1140065896 16:71610947-71610969 GAGGGTTGCATTTTGGGCAGAGG + Intergenic
1140213067 16:72986072-72986094 GAGGCCTGCTTTTTGGGAGTGGG - Intronic
1141448686 16:84081663-84081685 GAGGCTTGTATTTTGTGCAGAGG + Intronic
1142785293 17:2216987-2217009 GAATCTTCCTTTATGGGAAGGGG + Intronic
1145199855 17:20933739-20933761 GAGGCAAGCGTTTAGGGAAGTGG + Intergenic
1146182678 17:30708048-30708070 AAGTCTTGCTTTTGGGGAGGGGG - Intergenic
1148080836 17:44967121-44967143 GGGGCTTGCCCCTTGGGAAGTGG - Intronic
1148232727 17:45946911-45946933 GAAGGCTGCTTTTTGGGAGGAGG - Intronic
1148589116 17:48802256-48802278 GAAGCTTGCTTTCTGGCAAAGGG - Intronic
1151179799 17:72318975-72318997 GAGACTTGCTTTTTTCAAAGAGG - Intergenic
1152110683 17:78356158-78356180 GATGGGTGCTTTTTGGGAGGAGG + Intergenic
1153875210 18:9364288-9364310 GAGGCTCAGTTTTTGGGAGGAGG + Intronic
1155323104 18:24638273-24638295 TATGGTTGGTTTTTGGGAAGGGG + Intergenic
1157385465 18:47256377-47256399 AAAGCTTGCTTTTGGGTAAGTGG + Intergenic
1157638333 18:49184964-49184986 GAGGCTTTAGTTTTTGGAAGGGG + Intronic
1159906185 18:74094565-74094587 GAATCTTGCTTTCTGAGAAGTGG + Intronic
1162094365 19:8301976-8301998 GCTGCTTGCTTTTTGGGAGCAGG - Intronic
1162891906 19:13739615-13739637 GAGGCCTGGTATGTGGGAAGAGG - Intronic
1162976141 19:14207758-14207780 AAGTCTTGCTTTTGGGGAGGGGG + Intergenic
1167811321 19:51833796-51833818 GAGGCTGGAATTTTGGGAAGTGG + Intergenic
925175668 2:1782043-1782065 TTGGCTTGCTTTTGGGGAGGGGG - Intergenic
925776835 2:7344066-7344088 GAGGCATGGTCTTTGGGATGAGG + Intergenic
926287831 2:11504496-11504518 CAGGATTTCTTTTTGGGTAGTGG - Intergenic
926578856 2:14612945-14612967 GAGGCTTCCTGTTAGGGAAGAGG - Intergenic
930460612 2:51669618-51669640 GTTGCTAACTTTTTGGGAAGTGG + Intergenic
931657036 2:64518628-64518650 AAGGGCTGGTTTTTGGGAAGGGG + Intergenic
933298476 2:80517008-80517030 GAGGATTGTTTTCTGGGGAGGGG - Intronic
934103937 2:88679195-88679217 ATGGCTTGCTTTTGGGGAAAGGG + Intergenic
935825866 2:106948634-106948656 CAGGCTTGCTTGATGTGAAGTGG + Intergenic
937875497 2:126822606-126822628 GAGATTTGTTTTTTGGAAAGAGG + Intergenic
938664515 2:133520654-133520676 GAGGCTGTCATTTTGGGAAATGG + Intronic
940901693 2:159131600-159131622 GAGGCTTGGTTTCTGGCCAGTGG + Intronic
942452069 2:176114639-176114661 GGAGATTCCTTTTTGGGAAGAGG + Intronic
943319721 2:186432427-186432449 GATGCTTCATTTATGGGAAGAGG + Intergenic
943732307 2:191315220-191315242 GAGCTTTGCTTTTAGGGAGGAGG - Intronic
947170353 2:227304791-227304813 GAGTCTTATTTTCTGGGAAGTGG + Intronic
947232636 2:227903388-227903410 GAGGCTGGCACTTTTGGAAGAGG + Intronic
947771001 2:232669901-232669923 AAGGCATTCTTTTAGGGAAGAGG + Intronic
947931420 2:233968228-233968250 GGGGTTTGCTTCTTGGGAGGGGG - Intronic
948459365 2:238121700-238121722 GAGCCTTGTTTTTTGGGTAGAGG + Intronic
1169249199 20:4047153-4047175 TAGGCTTGCTGTCTGGGAAGGGG + Intergenic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1171167416 20:22984215-22984237 GAGACTTGGTTTCTGAGAAGAGG - Intergenic
1171458448 20:25285069-25285091 GAGGCTTACTCATTGGGAATAGG - Intronic
1173648518 20:44648660-44648682 GAGGCTACCTTCTTTGGAAGAGG - Intronic
1174676555 20:52362689-52362711 TAGGATTGCTTTTTGGGATCAGG + Intergenic
1174846688 20:53949602-53949624 GAGGCTTGGTCTTTGGAAAGCGG + Intronic
1175741076 20:61420191-61420213 GAGGCTTGCTCTCGGGGCAGAGG - Intronic
1175886831 20:62296954-62296976 GAGGCTTGGGTTGTGGGAAGTGG + Intergenic
1175936624 20:62517237-62517259 GAGGAGTGGGTTTTGGGAAGTGG + Intergenic
1176049243 20:63107942-63107964 GAGGCTCCCTTTGTGGGCAGTGG - Intergenic
1177582767 21:23048914-23048936 GAGGGTTTCTGATTGGGAAGAGG - Intergenic
1177707197 21:24721672-24721694 GACGCTTTTTTTTTTGGAAGAGG - Intergenic
1177745286 21:25205329-25205351 GAGTCTTCCTTCTTAGGAAGAGG - Intergenic
1179210113 21:39317268-39317290 GAGGTTTGCTTTTGGGTAAATGG + Intronic
1179664854 21:42904054-42904076 GAGGTTTCCTTTCTGGGCAGGGG - Exonic
1182059644 22:27387961-27387983 GGGGCTTGCCTTGGGGGAAGGGG - Intergenic
1182153027 22:28043724-28043746 GAGGATTGCTGTTGGGGGAGAGG + Intronic
1183013756 22:34969294-34969316 GAGGCTTTCTTTAAGAGAAGAGG + Intergenic
951579863 3:24151138-24151160 AAGACTTGCTTTTTGGAATGTGG - Intronic
952905765 3:38138345-38138367 GGGCCTTGCTTTTTGGGATCTGG - Intergenic
953543009 3:43839476-43839498 GAGGCCTCTTTTGTGGGAAGAGG - Intergenic
954663905 3:52240329-52240351 GAGGCCAGCTTTTTGGGCTGGGG + Intergenic
955646535 3:61144154-61144176 TGGGCTTTCTTTTTGGGATGAGG - Intronic
955776417 3:62438393-62438415 CAGGCTTGATTTCTGGAAAGAGG - Intronic
956785863 3:72641650-72641672 GAGGCTTCCTTGTCGGGAGGCGG + Intergenic
957349734 3:79008141-79008163 GAGAATTGCATTTTGGGAACTGG - Intronic
960049496 3:113226451-113226473 GAGGCTGGCTTTTTCTGGAGAGG - Intronic
960107249 3:113811112-113811134 GTTGCTTCCTCTTTGGGAAGAGG + Exonic
960184547 3:114622966-114622988 GTGAATTGCTTTTTGGAAAGAGG - Intronic
960325898 3:116295757-116295779 GAAGCTTCCTTTTTGGGACTTGG - Intronic
960418230 3:117411606-117411628 GAGCCATTATTTTTGGGAAGGGG + Intergenic
961316658 3:126040852-126040874 GTGGCTTGCCTTTAGTGAAGAGG - Intronic
962126853 3:132628978-132629000 GATGTTTGTTTTTAGGGAAGAGG - Intronic
962551914 3:136502089-136502111 GAGAATTGCTTTTGGGGAGGTGG + Intronic
964444788 3:156747647-156747669 GTGGCTTTCTCTTAGGGAAGAGG + Intergenic
967212717 3:187182839-187182861 GAGGCTTGTGTTTTGAGATGAGG + Intergenic
967225644 3:187288622-187288644 GACTCTTGCTTTTTGGGAACTGG - Intronic
967591603 3:191282460-191282482 AATGCTTGCTTTTAGTGAAGTGG - Intronic
969462676 4:7337047-7337069 GAGGCTGGCTTTTTGTGCCGAGG + Intronic
970644668 4:18106664-18106686 GAGGCTAGGCTTTCGGGAAGAGG + Intergenic
971382047 4:26107976-26107998 GAGGTTAGCTGTTGGGGAAGAGG - Intergenic
973886689 4:55329271-55329293 GAAGCTTGGACTTTGGGAAGGGG - Intergenic
975157756 4:71090549-71090571 GAGGCTATCAGTTTGGGAAGGGG + Intergenic
975788789 4:77924537-77924559 GAGGACTGCTTTGTGAGAAGGGG - Intronic
976576108 4:86673564-86673586 GAGGCTTTCTTCTTAGGCAGTGG + Intronic
977363991 4:96043226-96043248 GAGGCTTCTATTTTGGGATGTGG + Intergenic
978408661 4:108405791-108405813 GAGGCTTGCACTTTCGGAAGTGG + Intergenic
982253877 4:153433804-153433826 GATGGTTTCTTTTGGGGAAGGGG - Intergenic
982885660 4:160777955-160777977 AAAGCTTGGTTTTTGGGAACAGG - Intergenic
983078446 4:163354912-163354934 GATGCTGGCTTTCTGGAAAGTGG + Intergenic
987097305 5:14561201-14561223 GAGCCTTGCTTTATGGTATGTGG + Intergenic
987536061 5:19189202-19189224 AAGGCTTTTTTTTTGGGAGGGGG - Intergenic
988407328 5:30840813-30840835 TTGGATTGCTTTTTGGGCAGGGG - Intergenic
988436582 5:31182342-31182364 GAGGCTAGCCTCTTGGGAGGTGG - Intergenic
989113641 5:37930888-37930910 GAGTCTAGCTTTTTCTGAAGAGG + Intergenic
992501424 5:77347895-77347917 GAGGCTGGCTTTGTGAGCAGGGG + Intronic
992751581 5:79867434-79867456 GAGTCTTGCTGACTGGGAAGGGG + Intergenic
996576528 5:124982466-124982488 ATGGCTTGCTTTTTGGGGAGAGG - Intergenic
997839265 5:137224087-137224109 GAGGCTGGTTCTTTGGAAAGAGG + Intronic
999180267 5:149665229-149665251 CAGGCTTGGTCCTTGGGAAGGGG - Intergenic
1000722307 5:164723618-164723640 GATGCTTGCTTATTGGCAAATGG + Intergenic
1001244792 5:170098094-170098116 GAGGAAGGCTTTTGGGGAAGTGG + Intergenic
1003174204 6:3743255-3743277 GAGGCCTGTTCTTTGGGTAGTGG - Intronic
1006474702 6:34246544-34246566 GAGGCTTTCCTTCTGGGATGGGG - Exonic
1006742643 6:36320425-36320447 GAGGGTTGCTCATGGGGAAGTGG + Intronic
1012359767 6:98362478-98362500 GAGATTTGCTTTTTAGGGAGTGG + Intergenic
1015264423 6:131276280-131276302 GAGTTTTGGTTTTTGGCAAGAGG + Intronic
1020787657 7:12590957-12590979 GAGTTCTGCTTTTTGGGAGGAGG + Intronic
1022984682 7:35640025-35640047 GAGGTTTGCTTTTTTTGAGGTGG - Intronic
1024113154 7:46167116-46167138 GATGCTTTCTTTTTGGCAATGGG - Intergenic
1024587128 7:50851596-50851618 GAGGCTTCCCTTTTGGGCGGGGG + Intergenic
1026794085 7:73354626-73354648 GAGTAATGCATTTTGGGAAGGGG + Intronic
1028618276 7:92795118-92795140 GAGACTTGCTCTTTAGGAAATGG - Intronic
1029492912 7:100882009-100882031 AAGGCTTGGTTTTTGGGGAACGG - Intronic
1030742266 7:113124109-113124131 GAGGCTGATTATTTGGGAAGTGG + Intergenic
1031875449 7:127134058-127134080 TAGGCCTACTTTTTGGAAAGAGG - Intronic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032374075 7:131392230-131392252 GAGTCTTGGTTTTTGGTAAATGG + Intronic
1032890512 7:136190020-136190042 GAGGGTAGCATTTTGGGGAGAGG - Intergenic
1033360000 7:140632334-140632356 GAGGCTTGAGTTTAGGGAAGGGG - Intronic
1035347973 7:158219157-158219179 GAGACTTGCTTTATGGCATGTGG - Intronic
1035397342 7:158543897-158543919 GAGGGTTGCCTTGTGGGCAGGGG - Intronic
1035468889 7:159097256-159097278 GAGGCTTATTTTTAGGGATGTGG + Intronic
1037541235 8:19873416-19873438 GGAGCTTGCATTCTGGGAAGGGG + Intergenic
1037775829 8:21835034-21835056 GAGGCTGGCTTATGGGCAAGGGG - Intergenic
1038889167 8:31699586-31699608 GAGTCTTTCTTTCTGAGAAGAGG + Intronic
1040708584 8:50160414-50160436 GAGGTTTTCTTCTTGGAAAGAGG - Intronic
1041412809 8:57575250-57575272 GCAGCTTGGTGTTTGGGAAGAGG + Intergenic
1041618193 8:59932783-59932805 GCTGCATGCTTTTTGGGAACAGG - Intergenic
1041926484 8:63242484-63242506 GATCCTTGCTTGGTGGGAAGGGG + Intergenic
1043637100 8:82399565-82399587 GAGGCTTCCTTTTGTGGGAGAGG - Intergenic
1044083266 8:87911046-87911068 AAGGCTTGCTATTTGGGAGCAGG + Intergenic
1046619326 8:116511770-116511792 GAGACTTGGTGGTTGGGAAGGGG + Intergenic
1046878346 8:119280102-119280124 GAGTCTAGCTTTTTGGCCAGAGG - Intergenic
1048106730 8:131419283-131419305 CAGTCTTGCTTTTAGGGAATGGG + Intergenic
1048426908 8:134331505-134331527 GAGGCATGTGTTTTGGGATGGGG - Intergenic
1049187592 8:141266145-141266167 GAGCCATGCTTCCTGGGAAGCGG + Intronic
1052273850 9:26656496-26656518 GAGGCTTGCTTTTCGGGGATGGG - Intergenic
1052759009 9:32570373-32570395 AGGGCATGCATTTTGGGAAGTGG - Intronic
1054712775 9:68528110-68528132 AAGGCTTGCATTTTGGGAGGGGG - Intronic
1054982416 9:71222368-71222390 GTAGTTTGTTTTTTGGGAAGGGG + Intronic
1056428532 9:86503434-86503456 GAGGACTGCTTGTTGGGTAGTGG + Intergenic
1057031876 9:91782180-91782202 GAGGCTTGCTTTCTCTTAAGTGG + Intronic
1057183001 9:93039924-93039946 GGGGCTTGGATTCTGGGAAGTGG - Intergenic
1059243403 9:112827917-112827939 GAGGCTTGCATTTTCTAAAGAGG + Intronic
1059398195 9:114052044-114052066 GATGCTTTATTATTGGGAAGGGG - Exonic
1059691083 9:116686991-116687013 GAGGCTACCGTTTTGTGAAGGGG + Intronic
1059870267 9:118565431-118565453 GAGGTATGCGTTTTGAGAAGTGG - Intergenic
1061087390 9:128407088-128407110 TGACCTTGCTTTTTGGGAAGTGG - Intergenic
1061440887 9:130602701-130602723 AAGGTTTGCCTTTTGTGAAGAGG + Intronic
1062490835 9:136804165-136804187 GAGGCCAGGTTTTGGGGAAGAGG + Intronic
1185629021 X:1502630-1502652 GAGCCCTGCTATTTGGGGAGGGG + Intronic
1186425869 X:9464552-9464574 GTGGCTTCCTTTTTGGGGTGGGG + Intronic
1187255004 X:17634616-17634638 GATGGTTGCTGTTTGTGAAGTGG + Intronic
1188596294 X:31905319-31905341 TAAGCTTGCTTTTAGGGAAAAGG + Intronic
1189068920 X:37843939-37843961 GAGGGTTGGTTCATGGGAAGAGG + Intronic
1191182776 X:57580510-57580532 GATGCTAGCTTTTTGGGGGGGGG - Intergenic
1192354870 X:70392311-70392333 TAGTTTTGCTTTTTGGGGAGAGG + Intronic
1196316491 X:114231608-114231630 GAGATTTTCTTTTTGGGTAGTGG - Intergenic
1196898300 X:120359485-120359507 GAGGCTAGCTGTTCGGGAGGGGG + Intergenic
1197777076 X:130125496-130125518 GTGCCTTGCTTTCTGGGCAGAGG - Intergenic
1200926352 Y:8658412-8658434 GTGGCTAGGTATTTGGGAAGAGG - Intergenic