ID: 1064844670

View in Genome Browser
Species Human (GRCh38)
Location 10:19638310-19638332
Sequence CAGGGAAAACAAAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064844663_1064844670 30 Left 1064844663 10:19638257-19638279 CCTTTTTGTTATTTTCCATGAAT 0: 1
1: 1
2: 3
3: 65
4: 766
Right 1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG No data
1064844664_1064844670 15 Left 1064844664 10:19638272-19638294 CCATGAATTATATAAACATGTCA 0: 1
1: 0
2: 2
3: 30
4: 308
Right 1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064844670 Original CRISPR CAGGGAAAACAAAAGGAGGT GGG Intronic
No off target data available for this crispr