ID: 1064856802

View in Genome Browser
Species Human (GRCh38)
Location 10:19777667-19777689
Sequence AAACTGGGGCTCACCAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064856789_1064856802 23 Left 1064856789 10:19777621-19777643 CCACCACGTTATCTCAGATCAAC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 181
1064856795_1064856802 0 Left 1064856795 10:19777644-19777666 CCTGGGACTTGAGAATGTATGGG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 181
1064856790_1064856802 20 Left 1064856790 10:19777624-19777646 CCACGTTATCTCAGATCAACCCT 0: 1
1: 0
2: 1
3: 0
4: 56
Right 1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 181
1064856793_1064856802 1 Left 1064856793 10:19777643-19777665 CCCTGGGACTTGAGAATGTATGG 0: 1
1: 0
2: 4
3: 15
4: 135
Right 1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064856802 Original CRISPR AAACTGGGGCTCACCAAGAG GGG Intronic
902758480 1:18565311-18565333 AAAATGGGGCTCATCCAGTGGGG - Intergenic
903386814 1:22932416-22932438 AAACTGAGGCTCACAGAGATGGG + Intergenic
904698293 1:32342853-32342875 ATACTGAGGCTCACTCAGAGAGG - Intergenic
904826106 1:33274819-33274841 AAACTGAGGCTCAGAGAGAGGGG - Intronic
907194714 1:52677042-52677064 AAACTGAGGCTCAGCCAAAGTGG - Intergenic
907615964 1:55927067-55927089 AACCTGGGACCCACCAAGTGTGG + Intergenic
909473267 1:76053537-76053559 AAACTGAGGCTCACAAGGGGTGG - Intergenic
910309868 1:85810979-85811001 AAACTGTGGCTCAGCCAGGGAGG - Intronic
910670682 1:89769682-89769704 ATACTGGGGCTGCCCAAGAATGG + Intronic
911886900 1:103313281-103313303 AAACTGAGGCTCAGAAAGAGGGG + Intergenic
915745898 1:158157562-158157584 AAACTGGGGCTCAGCCTGGGAGG + Intergenic
917681378 1:177371637-177371659 AACCTGAGGCTCTGCAAGAGTGG - Intergenic
922158301 1:223057746-223057768 AAAATGGTGGTAACCAAGAGTGG - Intergenic
1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG + Intronic
1065186090 10:23172502-23172524 AAGCTGGGGCAGACCAAGGGCGG + Intergenic
1065197278 10:23278720-23278742 AACCAGGTGCTGACCAAGAGAGG + Intronic
1067452579 10:46391310-46391332 AAACAGGGTCTCCACAAGAGGGG + Exonic
1067584653 10:47468445-47468467 AAACAGGGTCTCCACAAGAGGGG - Exonic
1069915868 10:71786377-71786399 AAACTGAGGCCCAGAAAGAGTGG - Intronic
1070664091 10:78331470-78331492 CCCCTGGGGCTCACGAAGAGGGG + Intergenic
1072445406 10:95494828-95494850 AAATTGAGGACCACCAAGAGGGG - Intronic
1072766485 10:98098665-98098687 AAACTGGGGCATAGGAAGAGAGG - Intergenic
1073074815 10:100817260-100817282 AAACTGAGGCTCAGAGAGAGGGG - Intronic
1074084167 10:110194994-110195016 GAACTGGGGCTCACGCAGAGTGG - Intergenic
1078525354 11:12096781-12096803 TTACTGGGGCTCACAAACAGGGG + Intronic
1080588152 11:33699825-33699847 AAACCGGGGCTCTCCATGGGGGG - Intronic
1080858464 11:36132539-36132561 AAACTGGGGCACACAAAGGTTGG + Intronic
1086270251 11:85054609-85054631 AACCTAGTGCTCACCAACAGTGG + Intronic
1087772375 11:102224823-102224845 AAACTGAGGCTAATTAAGAGAGG + Intronic
1089061680 11:115630968-115630990 AAACTGAGGCTCAGAAAGACTGG + Intergenic
1090521606 11:127485851-127485873 AAACTTGGGTTCAGCAACAGTGG - Intergenic
1091662255 12:2393160-2393182 AAACCTGGGCTCACTAGGAGGGG + Intronic
1091960617 12:4691124-4691146 AAACTGAGGCTGACAAAGAGAGG - Exonic
1092329128 12:7566682-7566704 AGGCTGGGGCTCACCTGGAGAGG + Intergenic
1093028628 12:14267640-14267662 TAACTGGATTTCACCAAGAGAGG + Intergenic
1095964758 12:47859137-47859159 AATCTTGGGCTCCCCAAGCGAGG - Intronic
1097145658 12:56937703-56937725 CAACTGGGGCTCTCCAAGGCTGG - Intergenic
1097332416 12:58345901-58345923 AAACTGTGGCTCATCAAAAAAGG + Intergenic
1098878910 12:75896385-75896407 AGACTGGGGCTCAATAAAAGTGG - Intergenic
1101785875 12:107883141-107883163 AAATTGGGGTTCACCCAGAGGGG - Intergenic
1102226876 12:111235024-111235046 AAACTGAGGGTCAGAAAGAGAGG - Intronic
1102657167 12:114491802-114491824 AAACTGAGGCTCAGAAAGAAGGG + Intergenic
1103890675 12:124236780-124236802 AAGCTGTTGCTCACCCAGAGAGG + Intronic
1104616316 12:130272976-130272998 AAACTAGGGCTGACCATGAATGG + Intergenic
1105790023 13:23789709-23789731 AAACTGAGGGTCAACAAGAAGGG - Intronic
1106813281 13:33380746-33380768 AAAGTGGGGCTCAGGCAGAGAGG + Intergenic
1108598739 13:51972536-51972558 AAGCTTGGGGTCACCAAGAGGGG - Intronic
1111463696 13:88579666-88579688 GAACTGGGGCTTAAGAAGAGAGG - Intergenic
1112202764 13:97292680-97292702 GACCTGGGGCTCACCGAGAGAGG - Intronic
1112581312 13:100678644-100678666 AAGCAGGAGCCCACCAAGAGGGG - Intergenic
1114144436 14:19957188-19957210 ATACTGGTGCTCACTAACAGTGG + Intergenic
1115087865 14:29539027-29539049 ACCCTGGGGCTCACAAGGAGGGG + Intergenic
1116630662 14:47327151-47327173 AAACTGTGGCTCCCTAAAAGAGG + Intronic
1116965227 14:51007587-51007609 AAACTGGGGCACAGGAAGACTGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1122676972 14:103423604-103423626 AACCTTGGGGTCACCAAAAGAGG - Intronic
1122850816 14:104529422-104529444 AAAGTGGGGCTCAGCCTGAGAGG - Intronic
1202841691 14_GL000009v2_random:126750-126772 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202911079 14_GL000194v1_random:116982-117004 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1202881539 14_KI270722v1_random:65680-65702 AGACTGCGGCCCACAAAGAGAGG + Intergenic
1126583343 15:50260711-50260733 GAACTGGGGCTGACAGAGAGAGG + Intronic
1127971991 15:63969049-63969071 AAAATGGGGGTCACCAAGGATGG - Intronic
1128456306 15:67833513-67833535 AAACTGAGGCACAGTAAGAGAGG - Intronic
1129248716 15:74296315-74296337 AAACTGGGGCTCAAAAAAAGAGG + Intronic
1129830905 15:78669354-78669376 AAATTGGGACTCCCCAGGAGAGG - Intronic
1130326985 15:82889225-82889247 AAAGTGGGGCTGACCCAGTGTGG + Intronic
1133279259 16:4655834-4655856 AAACTGAGGCTCAGACAGAGGGG + Intronic
1134756197 16:16669834-16669856 AAACTTGGCATCACCAAGTGGGG - Intergenic
1134989871 16:18689330-18689352 AAACTTGGCATCACCAAGTGGGG + Intergenic
1136178830 16:28537400-28537422 AAACTGGGGCTCCTCCAGGGTGG - Intronic
1136396456 16:29995168-29995190 AAACTGGACCTTACCAAGAAGGG - Exonic
1138157005 16:54715182-54715204 AAACTGGGGCTCAGCACTGGTGG + Intergenic
1138850792 16:60627241-60627263 AAATTGAGGCTCACCCAGGGGGG + Intergenic
1138864391 16:60798683-60798705 AAACTGAGGCTAGCCAAGTGTGG - Intergenic
1141511277 16:84513863-84513885 AAACAGCTGCTCACCGAGAGTGG + Intronic
1141823983 16:86466493-86466515 AAAATGGGGCTCCTCAAGTGTGG - Intergenic
1141991592 16:87614027-87614049 AAACTGAGGCCCACCAAGGGAGG + Intronic
1152714063 17:81889923-81889945 GAACTGGAGTTCACCAAAAGCGG + Intronic
1152768093 17:82151757-82151779 TTACAGGGCCTCACCAAGAGAGG - Intronic
1154315623 18:13301155-13301177 ACACTGAGGCTCTCCAAGATAGG - Intronic
1155088504 18:22482536-22482558 AAACTGGGGCTTAGCCAGGGAGG - Intergenic
1156168933 18:34458480-34458502 AAATTGGGGCTCAGCCAGACAGG + Intergenic
1157601061 18:48893537-48893559 AAACCGGGGCTCAAGAGGAGGGG + Intergenic
1159337093 18:67082241-67082263 AAACTGGGGCTTAGCCAGGGAGG - Intergenic
1161802522 19:6424224-6424246 GCACTGGGGGTCACCAGGAGCGG - Intronic
1162044755 19:7991203-7991225 GACCTGGGCCTGACCAAGAGTGG + Intronic
1162494291 19:11014481-11014503 AATCTGGGTCTGACCACGAGGGG - Intronic
1165302544 19:34979889-34979911 AAACTGGGGCTTAGCATGTGAGG + Intergenic
1165576648 19:36825303-36825325 AACCTGTGGCTTAACAAGAGGGG - Intronic
1166300413 19:41909322-41909344 GGACTGGGGGTCAGCAAGAGTGG + Intronic
1202657151 1_KI270708v1_random:34777-34799 AGACTGCGGCCCACAAAGAGAGG + Intergenic
925785780 2:7430633-7430655 AGGCTGGGACTCAGCAAGAGCGG + Intergenic
926634366 2:15164468-15164490 AAACTGAGGCTCAGAGAGAGAGG + Intergenic
928223075 2:29421241-29421263 AAACTAAGGCTCACCAAAGGCGG - Intronic
929817432 2:45245333-45245355 AAAATGTGGCTTGCCAAGAGTGG - Intergenic
932088564 2:68784428-68784450 AAACTGGTGATCACAGAGAGAGG - Intronic
932576332 2:72964283-72964305 CAACAGGGGCTCCCCAAGGGTGG + Intronic
935423459 2:102894840-102894862 TAGCTGAGGCTCACCAGGAGGGG - Intergenic
936491934 2:112979411-112979433 ACAATGGGGCCCACCAGGAGTGG + Intronic
936720854 2:115251332-115251354 AAATAGGGCCTCACAAAGAGAGG - Intronic
938597434 2:132802178-132802200 AGACTAGGACTCACCAAGACGGG - Intronic
941638264 2:167959968-167959990 AAATTGAGGCTCACAAAGCGTGG - Intronic
947330970 2:229029057-229029079 ACACTGGGGACCACCAGGAGGGG + Intronic
947617154 2:231565502-231565524 AAACTGGGGCTTAGCCTGAGAGG + Intergenic
947834271 2:233164106-233164128 GAACCGGGGCTGACCAAGGGTGG - Intronic
948900804 2:240956077-240956099 AAACTGAGGCTCAGGAAGGGAGG - Intronic
949048986 2:241887082-241887104 ACACTGGGCCTCAGGAAGAGCGG - Intergenic
1170543782 20:17415511-17415533 AAACTGCTGCTCAACAAAAGAGG + Intronic
1172354056 20:34266913-34266935 AAACTGAGGCACACTAAGACAGG - Intronic
1173288220 20:41691994-41692016 AAACTGGGGCTCAGCTTGGGAGG - Intergenic
1174140808 20:48412442-48412464 AAACTGGGGCTCAGCCTGGGAGG - Intergenic
1174451216 20:50621670-50621692 AAACTGGGGCCAACACAGAGAGG + Intronic
1174488309 20:50874869-50874891 GAACTGGGTCTCAGCCAGAGTGG + Intronic
1174697069 20:52570917-52570939 AAACTGGGGCTCACCCCCACTGG + Intergenic
1175502044 20:59457357-59457379 AAACTGAGGTTCAGAAAGAGTGG + Intergenic
1176597020 21:8757115-8757137 AGACTGAGGCCCACCAAGAGAGG + Intergenic
1176630434 21:9131679-9131701 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1176642835 21:9323060-9323082 AGACTGAGGCCCACCAAGAGAGG + Intergenic
1178026817 21:28477853-28477875 AAACTGGGGCTTAGCCTGAGAGG - Intergenic
1178026826 21:28477917-28477939 AAACTGGGGCTTAGCCTGAGAGG - Intergenic
1180351858 22:11812463-11812485 AGACTAAGGCCCACCAAGAGAGG + Intergenic
1180370097 22:11976139-11976161 AGACTAAGGCCCACCAAGAGAGG - Intergenic
1180386346 22:12179607-12179629 AGACTAAGGCCCACCAAGAGAGG - Intergenic
1180421421 22:12817717-12817739 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1181914448 22:26268383-26268405 AAACTGAGGCTCAGCAAGGAGGG + Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG + Intronic
1184738623 22:46413855-46413877 AAGGTGGGGCTCACAAAGTGAGG - Intronic
950062373 3:10082645-10082667 AAGCTGGGGATCAAGAAGAGTGG - Intronic
950285335 3:11740465-11740487 AAACTGGGGAAAACCAAGATTGG - Intergenic
950402720 3:12782374-12782396 AAACTGGGGCTCAGCCTGGGAGG + Intergenic
950560625 3:13719538-13719560 AAACTGAGGCTCAGAAAGGGTGG + Intergenic
950720548 3:14879500-14879522 AAGCTGGGGCTCACCATCTGAGG + Intronic
952007555 3:28859323-28859345 AAACTAGGGCTCACTGAGAAAGG + Intergenic
954378477 3:50206958-50206980 AAACTGAGGCACAACAAGACTGG + Intronic
955327787 3:58022690-58022712 AAACTGAGGCACACCCAGATTGG + Intronic
955365771 3:58308659-58308681 GAACTGGGTCTAACCCAGAGTGG + Intronic
957097248 3:75787508-75787530 AGACTGAGGCCCACCAAGAGAGG - Intergenic
958638737 3:96778391-96778413 AAACTGGGGTCCACCAAGTGGGG + Intergenic
959300900 3:104599542-104599564 AAAATGCTGCTCAGCAAGAGAGG - Intergenic
959450735 3:106496509-106496531 AAACTGGAGCTCACTAAGGCAGG + Intergenic
960672258 3:120165208-120165230 AATCTGGGGCTGGCCAGGAGGGG - Intronic
961186317 3:124918267-124918289 CACCTGGGGCTCACCTAGAAAGG - Intronic
962223936 3:133588745-133588767 AAACTGGGGTCCACCAAGTGGGG + Exonic
962631705 3:137283001-137283023 AAACAGGGACTCAGCAACAGAGG - Intergenic
963248128 3:143081869-143081891 AAACTGCTGTTCACCACGAGAGG - Intergenic
967648890 3:191961441-191961463 AAAATGGGGCTCACTCAGCGAGG - Intergenic
1202744050 3_GL000221v1_random:81953-81975 AGACTGAGGCCCACCAAGAGAGG - Intergenic
969431272 4:7156080-7156102 AAACTGAGGCTCAACAAGCTTGG - Intergenic
969702010 4:8772942-8772964 AAACTGAGGCTCAGGAGGAGCGG - Intergenic
971743878 4:30553594-30553616 GAACTGGGCCTCACCACGGGAGG + Intergenic
973360318 4:49159337-49159359 AGACTGAGGCCCACCAAGAGAGG + Intergenic
974401111 4:61408315-61408337 CAACAGGGGCTCAGCAAGAGAGG - Intronic
980095741 4:128488701-128488723 ATATTGTGGCTGACCAAGAGGGG - Intergenic
980996381 4:139783675-139783697 AATCTGGGGATGCCCAAGAGAGG + Intronic
984197560 4:176677147-176677169 AAATTGGGGCTCAGCCAGGGAGG - Intergenic
986083964 5:4424374-4424396 AATCTTGGGCTCAGCCAGAGAGG - Intergenic
992508436 5:77410090-77410112 AAACTGGGGCTCAGCCCGGGAGG + Intronic
993375372 5:87144020-87144042 ACACTGGGGCCCATCAGGAGTGG - Intergenic
997610799 5:135214181-135214203 GTCCTGGGGCTCACCTAGAGTGG - Intronic
1002191647 5:177481310-177481332 AAACTGGGTCTCACCAGGCCGGG + Intergenic
1003397901 6:5769365-5769387 AAACAGAGGCTCTCCAGGAGTGG - Intronic
1007171948 6:39870320-39870342 ATCCTGGGGGTCACCAAGGGAGG - Exonic
1007210742 6:40191887-40191909 AGACTGGGGCTCCCTGAGAGTGG - Intergenic
1009842200 6:69092002-69092024 AATCTAGGGCTCAGGAAGAGGGG - Intronic
1010768803 6:79805452-79805474 AAATTGTGGCTCTCCAAAAGGGG + Intergenic
1011536957 6:88386052-88386074 AAATTGGGGCTCACCCTGGGAGG + Intergenic
1013668334 6:112371074-112371096 TAACTGGTGCTCACCAGGATTGG - Intergenic
1014817288 6:125950016-125950038 AAACTGCTGTTCACCAAGATGGG - Intergenic
1015303210 6:131677587-131677609 GGACTGGGACACACCAAGAGTGG + Intronic
1015521081 6:134131895-134131917 AAACTCAGGCTCACAGAGAGTGG + Intergenic
1016310504 6:142728486-142728508 TAACTGGGGCTCCTCAAGTGAGG + Intergenic
1018623331 6:165752322-165752344 AAACTGGGGCTTAGCCTGAGAGG - Intronic
1020678001 7:11203104-11203126 AAACTGGGGGTCACAAAGAATGG - Intergenic
1022860015 7:34357998-34358020 ACTCCGGGGCTCACCACGAGTGG - Intergenic
1025950801 7:66143937-66143959 AAACTGAGGCTCAGGGAGAGTGG + Intronic
1028953699 7:96665279-96665301 ACACAGGAGCTCACCAAGGGGGG + Intronic
1031373365 7:120995234-120995256 AATAAGGGGTTCACCAAGAGAGG - Intronic
1032415823 7:131734673-131734695 ACTCTGGGGCTCACCAAGTGTGG + Intergenic
1033527258 7:142228572-142228594 AAATTGGGGCTCAGCCAGACAGG + Intergenic
1033847210 7:145448151-145448173 AAACTGGGGCTCTTCCCGAGAGG - Intergenic
1034162791 7:149005251-149005273 GACCTGGGGCTCAGCGAGAGTGG - Exonic
1035659930 8:1339472-1339494 AGAATGGAGCTCACCAAGGGAGG - Intergenic
1036479375 8:9124666-9124688 AAACAGGTGCTCACCCACAGGGG + Intergenic
1036760995 8:11508484-11508506 GGAATGTGGCTCACCAAGAGGGG - Intronic
1037231878 8:16668975-16668997 AAACAGGAGCTCAGCAGGAGAGG + Intergenic
1037700704 8:21271676-21271698 ACTCTGGGGCTCCCCAAGATGGG - Intergenic
1039847210 8:41334071-41334093 AAACTGGGGCTTAGCCTGAGAGG - Intergenic
1041112012 8:54492038-54492060 AAACTGGGTCAAACCAAGAGGGG + Intergenic
1043741989 8:83825630-83825652 AAACTGGGGCTCAGAGAGATTGG + Intergenic
1045435481 8:102159251-102159273 AAACTGAGGCTCACCAAAGTTGG + Intergenic
1048508687 8:135043210-135043232 AAACAGGGGCTGCCCAGGAGTGG - Intergenic
1048576416 8:135693625-135693647 GAATGTGGGCTCACCAAGAGGGG + Intergenic
1053262679 9:36683444-36683466 AAACTGAAGCACACAAAGAGTGG - Intergenic
1057826701 9:98377406-98377428 TAACTGGAGCTCACTCAGAGGGG + Intronic
1059374116 9:113869009-113869031 AAACTGGGGCTCAGAGACAGTGG + Intergenic
1060852144 9:126886842-126886864 AAACTGGGGCTAACGAAGGTAGG - Intergenic
1061012576 9:127964151-127964173 AAGTTGAGGCTCACCAAGATGGG - Intronic
1203753263 Un_GL000218v1:99364-99386 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1203712682 Un_KI270742v1:111919-111941 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1203556277 Un_KI270743v1:210238-210260 AGACTGAGGCCCACCAAGAGAGG - Intergenic
1186996426 X:15128468-15128490 AAACTGGGTCTCACTTGGAGAGG - Intergenic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1189310443 X:40014137-40014159 AGACTGGAGCTCCCCAGGAGAGG - Intergenic
1190907279 X:54739391-54739413 ACACTGGGGCTCACAAAGAGTGG - Intergenic
1191722813 X:64248793-64248815 AAACCGTGCCTCACCACGAGAGG - Intergenic
1192082589 X:68062840-68062862 AGACTGGGGCTAATCCAGAGGGG - Intronic
1199735752 X:150685377-150685399 CACATGGGGCTCACCAAAAGTGG - Intergenic
1200691215 Y:6307281-6307303 AGACAGGGGATCAACAAGAGAGG + Intergenic
1201044057 Y:9867435-9867457 AGACAGGGGATCAACAAGAGAGG - Intergenic
1201166909 Y:11216933-11216955 AGACTGGGGCCCACAAAGAGAGG - Intergenic
1201865653 Y:18650993-18651015 AAACTTGGGCTATCCATGAGTGG + Intergenic