ID: 1064859831

View in Genome Browser
Species Human (GRCh38)
Location 10:19815779-19815801
Sequence CCCCCCGCAGTCGGGCGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064859817_1064859831 16 Left 1064859817 10:19815740-19815762 CCAGGGAGACCCCGCCAGGGTCG No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859825_1064859831 6 Left 1064859825 10:19815750-19815772 CCCGCCAGGGTCGGGGCGGGGCG No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859824_1064859831 7 Left 1064859824 10:19815749-19815771 CCCCGCCAGGGTCGGGGCGGGGC No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859813_1064859831 26 Left 1064859813 10:19815730-19815752 CCTTTCGTGCCCAGGGAGACCCC No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859816_1064859831 17 Left 1064859816 10:19815739-19815761 CCCAGGGAGACCCCGCCAGGGTC No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859827_1064859831 2 Left 1064859827 10:19815754-19815776 CCAGGGTCGGGGCGGGGCGCGAT No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859812_1064859831 27 Left 1064859812 10:19815729-19815751 CCCTTTCGTGCCCAGGGAGACCC No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data
1064859826_1064859831 5 Left 1064859826 10:19815751-19815773 CCGCCAGGGTCGGGGCGGGGCGC No data
Right 1064859831 10:19815779-19815801 CCCCCCGCAGTCGGGCGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064859831 Original CRISPR CCCCCCGCAGTCGGGCGCGA AGG Intergenic