ID: 1064860188

View in Genome Browser
Species Human (GRCh38)
Location 10:19817374-19817396
Sequence TCAAGAAAACCCCTAGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064860188_1064860195 9 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860195 10:19817406-19817428 GCTTACTTCACCTGGGCGGCAGG No data
1064860188_1064860196 10 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860196 10:19817407-19817429 CTTACTTCACCTGGGCGGCAGGG No data
1064860188_1064860194 5 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860194 10:19817402-19817424 TCGGGCTTACTTCACCTGGGCGG No data
1064860188_1064860193 2 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860193 10:19817399-19817421 CTTTCGGGCTTACTTCACCTGGG No data
1064860188_1064860192 1 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860192 10:19817398-19817420 GCTTTCGGGCTTACTTCACCTGG No data
1064860188_1064860198 12 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860198 10:19817409-19817431 TACTTCACCTGGGCGGCAGGGGG No data
1064860188_1064860197 11 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860197 10:19817408-19817430 TTACTTCACCTGGGCGGCAGGGG No data
1064860188_1064860199 15 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860199 10:19817412-19817434 TTCACCTGGGCGGCAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064860188 Original CRISPR TCAAGAAAACCCCTAGTCCC CGG (reversed) Intronic