ID: 1064860195

View in Genome Browser
Species Human (GRCh38)
Location 10:19817406-19817428
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064860188_1064860195 9 Left 1064860188 10:19817374-19817396 CCGGGGACTAGGGGTTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1064860195 10:19817406-19817428 GCTTACTTCACCTGGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type