ID: 1064860672

View in Genome Browser
Species Human (GRCh38)
Location 10:19821689-19821711
Sequence GGATGGACAAAGTCTTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064860672_1064860677 10 Left 1064860672 10:19821689-19821711 CCATGCTAAGACTTTGTCCATCC 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1064860677 10:19821722-19821744 AATAAATTTAAAACGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064860672 Original CRISPR GGATGGACAAAGTCTTAGCA TGG (reversed) Intronic
901285743 1:8077239-8077261 GGATGGAAAATGACTTGGCAGGG + Intergenic
902811193 1:18888985-18889007 GGATGGATAAACTCCAAGCATGG + Intronic
903548222 1:24140542-24140564 GGCTGGACAAAGACCTAGCCTGG - Intronic
906040687 1:42785774-42785796 GGATGAACAAAGAATTAGGAGGG - Intronic
914715142 1:150248351-150248373 GGATGAACAAAGGCTGGGCACGG - Intergenic
915075378 1:153304216-153304238 GAGTGGATAAAGTCTTAGCTTGG - Intronic
917697954 1:177547847-177547869 GGATGGACAAAGTTATTTCATGG + Intergenic
917717117 1:177749477-177749499 TGATGGACAAAGTCATAGGCAGG + Intergenic
924592338 1:245415463-245415485 GGATGGATAACTTCTTACCAAGG - Intronic
1063241153 10:4170454-4170476 GGATGGACAGAGTCTCAACAGGG + Intergenic
1063263463 10:4417277-4417299 GGATGAACAAAGGCTTAACTAGG + Intergenic
1064860672 10:19821689-19821711 GGATGGACAAAGTCTTAGCATGG - Intronic
1069748806 10:70732740-70732762 GGCTGGATCAAGTCTTAGAAAGG - Intronic
1086485201 11:87292767-87292789 ATATTGATAAAGTCTTAGCATGG - Intronic
1086814797 11:91356430-91356452 GGATGGATAAATTGTGAGCATGG + Intergenic
1087024431 11:93635939-93635961 GGATGCTCAAATTCTTAGAAAGG - Intergenic
1092035332 12:5329552-5329574 GGAGGGTCAAAGTCTAAGAAAGG + Intergenic
1094832673 12:34307613-34307635 GGATGGAAAAAATATTGGCACGG + Intergenic
1097561962 12:61218703-61218725 GGATAGACAAAGTCTTAGTGAGG - Intergenic
1100777843 12:97991800-97991822 GGATGGACCCAGTCTAATCATGG - Intergenic
1101851973 12:108410588-108410610 GGCTGGACAATGACTTGGCAGGG - Intergenic
1106477123 13:30108462-30108484 GGGTGGGCAGAGTCATAGCAGGG - Intergenic
1109164484 13:59016819-59016841 GGAGGGACAAAGTCTATGTAAGG + Intergenic
1109631467 13:65054556-65054578 GGATGGAGAAAGGCTTAACATGG + Intergenic
1110962463 13:81645479-81645501 ATATGGAGAAAGTTTTAGCAAGG + Intergenic
1118380614 14:65214715-65214737 GGATGGACCAAGCCCCAGCATGG - Intergenic
1122099372 14:99394969-99394991 GGAGAGAGGAAGTCTTAGCAGGG - Intergenic
1127290243 15:57563471-57563493 GAATGGTCAAATTCTAAGCAGGG - Intergenic
1127676531 15:61244633-61244655 GCATGGAGAAAGACTTATCAGGG - Intergenic
1128801318 15:70498890-70498912 GGTGGGACACAGTCATAGCAGGG - Intergenic
1136091211 16:27921334-27921356 TGCTGGACCAAGTCTTGGCAGGG - Intronic
1136451291 16:30355599-30355621 GGAGGGGCAAAGTCCGAGCAGGG + Intergenic
1139187506 16:64823970-64823992 GGAGGGACCAAGGCTTAGAAAGG + Intergenic
1140350141 16:74254526-74254548 GGATGTAGAAAGACTTAGTAAGG - Intergenic
1146414816 17:32622042-32622064 GGATGGAGACTGTCTTAGCATGG - Intronic
1150009531 17:61491187-61491209 GGTTTGACAAAGTCTGAGCCAGG + Intergenic
1158497749 18:57971783-57971805 AGATTGACAAAATCCTAGCAGGG + Intergenic
1168611064 19:57800766-57800788 TGATGGGCAAAGTCTTGGAAAGG + Intronic
1168623176 19:57895183-57895205 GGAAGGACTAAATCTTAGGAAGG + Intronic
929545513 2:42853038-42853060 TCATGGACCAAGTCTTAGGAAGG + Intergenic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
936626638 2:114155945-114155967 GGAAAGACCAAGTCTTAGCAAGG + Intergenic
937252155 2:120531536-120531558 AGATGGAAAAAGTGCTAGCATGG + Intergenic
937491119 2:122369091-122369113 AGATGGGCAAAGACTTATCATGG + Intergenic
938395120 2:130940314-130940336 GAATGGATAAAGTTTCAGCAGGG + Intronic
939791557 2:146584444-146584466 TGCTGAACAAAGCCTTAGCAAGG + Intergenic
940391790 2:153141016-153141038 GGATGGACAGAGTGGTAGAATGG - Intergenic
940710073 2:157152279-157152301 TGATAGACAAAATCTTACCATGG + Intergenic
947479480 2:230485246-230485268 GGAGGGGAAAAGTCTTAGCTGGG - Intronic
948372567 2:237498929-237498951 GGAGGGACAAAGGCTGAGAAGGG - Intronic
1169687098 20:8287649-8287671 GGATGTACAAAGAATCAGCATGG + Intronic
1170974219 20:21147080-21147102 TGATAGACATATTCTTAGCACGG + Intronic
1174521840 20:51137537-51137559 GGATGGAGAAGGTTTTAGCCAGG - Intergenic
1175090623 20:56500554-56500576 GGAGGGAAAAACTCTTAGCCTGG - Intronic
1176974025 21:15298203-15298225 GGAGAGACAAAGTCTCAGCTGGG + Intergenic
1177457821 21:21366039-21366061 GGGTGGACAAAGGCTCAGAATGG + Intronic
1182681713 22:32084680-32084702 GGATGGACAGAGTCTTCTCCAGG + Intronic
952988716 3:38812074-38812096 GGATGGTCATAGGCTAAGCATGG - Intergenic
956312567 3:67897598-67897620 TGATGGACAATGTATTACCAGGG + Intergenic
957941240 3:87007233-87007255 GGATGGACAGACTCTTAGAGAGG - Intergenic
964396150 3:156248083-156248105 GGAGGGACAAAGTCTTCTCAAGG - Intronic
966285941 3:178295569-178295591 TGATGGGAAAAGTCTTTGCAGGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970347318 4:15165180-15165202 GGATGGACAAAAACTTACCAAGG - Intergenic
975312295 4:72915993-72916015 GGATGGACAAGATCAGAGCAAGG - Intergenic
975365762 4:73525638-73525660 GGATAAACAAAGTTATAGCATGG + Intergenic
977464397 4:97365117-97365139 TGATGGACAAAGAATTAGAAAGG + Intronic
979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG + Intergenic
979126496 4:116979886-116979908 GGAAGGACAAATTATTAACATGG - Intergenic
982178170 4:152726043-152726065 GGATGGATAAATTCTTGTCATGG - Intronic
982666309 4:158268888-158268910 AGATGGACACAGTCTTCACATGG - Intergenic
984191278 4:176608705-176608727 GTGTAGACACAGTCTTAGCAAGG + Intergenic
985671135 5:1207222-1207244 GGAGGGACACAGCCTTGGCAGGG - Intronic
987483775 5:18495940-18495962 GGAGGGACAAAATCAAAGCAAGG + Intergenic
990101134 5:52188762-52188784 TGATAGACAAAGTGTCAGCAGGG - Intergenic
990796139 5:59543359-59543381 GAATGAACAAATTCTTAGAAGGG + Intronic
991187150 5:63823028-63823050 AAATGGACAAAGCTTTAGCATGG + Intergenic
991259911 5:64655715-64655737 GGAGGGACAGATTCATAGCAAGG + Intergenic
994084320 5:95742059-95742081 GGATAGGCAAAGTCTGAGCCTGG - Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
1001102409 5:168825118-168825140 GGCTGGTAAAAGGCTTAGCATGG + Intronic
1003093890 6:3127083-3127105 GGATGGATTAAGTCATTGCAAGG + Intronic
1005714402 6:28533289-28533311 GGATATATAAAGTCTTAACATGG - Intronic
1006206571 6:32349031-32349053 TGAGGGACAAAATCTCAGCAGGG + Intronic
1006625926 6:35397773-35397795 GGATGGAGAAAGTTGAAGCAGGG + Intronic
1010967772 6:82232499-82232521 AGATGAATAAAGTCTTAGAATGG + Intronic
1013534300 6:111049575-111049597 AAATGGACAAAACCTTAGCAAGG - Intergenic
1014836283 6:126164826-126164848 GGATGGAGGAAGACTTACCAAGG - Intergenic
1017752476 6:157500757-157500779 GGATGGACAAAGCCTTAAAATGG + Intronic
1032906985 7:136379786-136379808 GGATGGACAAAAACTCAGAAGGG - Intergenic
1032948447 7:136879140-136879162 AGGTGGAAAAAGTCTCAGCAAGG + Intronic
1033420391 7:141200133-141200155 GGCTTGCCAAAGTCTTAGGATGG + Intronic
1038483027 8:27914749-27914771 GAGTGGACAAAGCCTGAGCAGGG - Intronic
1038692687 8:29777129-29777151 GAATGGAGAATATCTTAGCATGG - Intergenic
1038704761 8:29883413-29883435 GGAAGCCCAAATTCTTAGCATGG - Intergenic
1053512274 9:38698153-38698175 TGATGGACAAAATGTTAACATGG + Intergenic
1058980207 9:110161941-110161963 AGATGGAGAAAGTTTTGGCATGG + Intronic
1059822606 9:117990739-117990761 TGATTGACTAAGTCTTAGTATGG + Intergenic
1060280345 9:122211751-122211773 GTATGGACAGAGTCCTGGCAGGG + Intronic
1189227235 X:39423044-39423066 GGATGGACTATGTATCAGCAAGG - Intergenic
1194475349 X:94352197-94352219 GAATGGCCAAAGTTTTAGAAAGG + Intergenic
1194683053 X:96877632-96877654 AGATGGACTTAGTCTGAGCATGG - Intronic
1194927166 X:99838696-99838718 GGAAGGGCAAAGTCTTAGTATGG + Intergenic
1196208207 X:112965279-112965301 GGAAGTTCAAAGTCTTAACAAGG + Intergenic
1202605634 Y:26637543-26637565 GAATGGACAAAGTCACAGGAGGG - Intergenic