ID: 1064862879

View in Genome Browser
Species Human (GRCh38)
Location 10:19846669-19846691
Sequence CACACTGCATATCTTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064862879_1064862885 -2 Left 1064862879 10:19846669-19846691 CCAATGTCAAGATATGCAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1064862885 10:19846690-19846712 TGGGAAGAGGGAAACATGGAAGG No data
1064862879_1064862886 10 Left 1064862879 10:19846669-19846691 CCAATGTCAAGATATGCAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1064862886 10:19846702-19846724 AACATGGAAGGACAGTCTCGTGG No data
1064862879_1064862884 -6 Left 1064862879 10:19846669-19846691 CCAATGTCAAGATATGCAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1064862884 10:19846686-19846708 AGTGTGGGAAGAGGGAAACATGG No data
1064862879_1064862887 11 Left 1064862879 10:19846669-19846691 CCAATGTCAAGATATGCAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1064862887 10:19846703-19846725 ACATGGAAGGACAGTCTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064862879 Original CRISPR CACACTGCATATCTTGACAT TGG (reversed) Intronic
904929025 1:34071744-34071766 CACACTGCTTAACGTGCCATTGG + Intronic
909033642 1:70571398-70571420 GACACTGCATATATTGAAGTTGG + Intergenic
911374452 1:97034583-97034605 CACACTGCATATGTGTATATTGG - Intergenic
911443770 1:97964552-97964574 CACACTGCATCTACTGACATAGG + Intergenic
916832746 1:168509953-168509975 CACACTGCTTATGGGGACATTGG - Intergenic
917667213 1:177236789-177236811 CACCATGCACTTCTTGACATGGG - Intronic
923167416 1:231379288-231379310 CTTACTGTACATCTTGACATGGG - Intronic
1062896390 10:1106364-1106386 CACACTGCTTATCCAGACGTCGG - Intronic
1064862879 10:19846669-19846691 CACACTGCATATCTTGACATTGG - Intronic
1068087695 10:52395306-52395328 AACACAGCATACCTTGATATTGG + Intergenic
1069768618 10:70883043-70883065 CAGACTGCCTTTCTAGACATAGG + Intronic
1075302175 10:121334694-121334716 TACACTACATATGCTGACATAGG - Intergenic
1075411183 10:122229149-122229171 GACAATGCACATCTTGAGATTGG - Intronic
1076334764 10:129698303-129698325 AACACTGCATGCCTGGACATGGG - Intronic
1081092774 11:38893687-38893709 CAAGCAGCATATCTTCACATTGG + Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1086428411 11:86710817-86710839 CACACTGAATATCTTATGATTGG - Intergenic
1087991974 11:104756191-104756213 TACACTTCATATTTTGACCTTGG - Intergenic
1093964261 12:25308726-25308748 CAGACTGAATGTATTGACATGGG + Intergenic
1096438760 12:51620022-51620044 CACACTGAATGTCTTGATCTAGG - Intronic
1098367622 12:69721253-69721275 CACACTGCATTCCCTGACAAGGG + Intergenic
1103450874 12:121027953-121027975 CACATTCCATCTCTAGACATAGG + Intronic
1104165723 12:126227686-126227708 CACACTGCATAGCTTAAACTGGG - Intergenic
1104374446 12:128251424-128251446 TACACTGCTCCTCTTGACATTGG + Intergenic
1104718314 12:131030933-131030955 CACACTGCACATTGTGACAGAGG - Intronic
1107854772 13:44603959-44603981 AAGACTGCATATGTTCACATGGG - Intergenic
1108992050 13:56671943-56671965 CACATTTCATAACTTGATATTGG + Intergenic
1111299995 13:86336432-86336454 GATACTGGTTATCTTGACATTGG + Intergenic
1111311451 13:86492261-86492283 CACACAACAAATCTTGACATAGG + Intergenic
1112531554 13:100208680-100208702 CACACTGAATACCTTGACAATGG - Intronic
1118886664 14:69872881-69872903 CACACTGCATACCTAGACCCTGG + Intronic
1124505925 15:30273233-30273255 CTCAATTCATATCTTGAGATTGG - Intergenic
1124737628 15:32265399-32265421 CTCAATTCATATCTTGAGATTGG + Intergenic
1126675173 15:51154718-51154740 CACACTCTATTTCTTGACCTGGG + Intergenic
1126994480 15:54424927-54424949 CACTCTGCATTACTTGTCATTGG + Intronic
1127392423 15:58517374-58517396 AACACTGCATATCTTCACCCAGG + Intronic
1128096847 15:64963195-64963217 CAGATTGCATATCAGGACATTGG - Exonic
1129174163 15:73827988-73828010 CACAGTGAATTTCTTGAGATTGG - Intergenic
1129643080 15:77402289-77402311 TAAAATGCATATCTAGACATCGG + Intronic
1140763249 16:78131146-78131168 CACACTGCATAACAACACATTGG - Intronic
1148222875 17:45876625-45876647 CACTCTGGATATCCTGGCATAGG - Intergenic
1148573523 17:48690419-48690441 CACACTGGATCTCTGTACATGGG - Intergenic
1149046293 17:52249600-52249622 CACACTGAATTTCTTTAAATAGG + Intergenic
1150491765 17:65579174-65579196 CTCACTGCATATCTTAGCCTGGG + Intronic
1155043494 18:22084388-22084410 CACAATGCATCTCTTGTCAAGGG - Intergenic
1158116276 18:53999622-53999644 CACAATGCATACCTTTAAATTGG + Intergenic
1159576301 18:70182191-70182213 CAAACTGCATATTTTAAAATGGG - Intronic
1162620154 19:11836531-11836553 CACACTGGAGAGCCTGACATCGG + Intergenic
1162629434 19:11915421-11915443 CACACTGGAGAGCCTGACATTGG + Intergenic
1162634131 19:11953299-11953321 CACACTGGAGAGCCTGACATTGG + Intronic
1162637503 19:11981494-11981516 CACACTGGAGAGCCTGACATTGG + Intergenic
1163215322 19:15872126-15872148 TACAGTGCTTATTTTGACATGGG - Intergenic
1166817125 19:45553061-45553083 CACACTGCATTTCCTTACAGTGG + Intronic
925960414 2:9009278-9009300 CAAACTGCATATTTTGTTATGGG + Intergenic
927793171 2:26026774-26026796 CTGCCTGCATATCTTGACTTAGG - Intergenic
931574996 2:63709436-63709458 CACATTTCATATCTAGTCATGGG + Intronic
935884833 2:107605524-107605546 CACTCTGCAGATTTTTACATGGG - Intergenic
941215656 2:162705200-162705222 CACATTGCATATTCTGTCATGGG + Intronic
1171314244 20:24173971-24173993 CACACAGCCTATCTTTGCATGGG + Intergenic
1172668171 20:36615064-36615086 CAGCCTGCATTTCTTGGCATAGG + Intronic
1173023955 20:39290453-39290475 CACACTCCATTTCTTGACCTGGG + Intergenic
1182256778 22:29044783-29044805 CCCACTGAATACTTTGACATGGG + Exonic
1182753984 22:32663939-32663961 CACACTGCACATTTTGAAAAAGG + Intronic
949667275 3:6354575-6354597 CACACTTGATATCTTGACTGTGG - Intergenic
951950191 3:28191531-28191553 AAAACTGCGAATCTTGACATTGG + Intergenic
954282113 3:49588604-49588626 AACACTGCATATCAAAACATTGG - Intronic
955324558 3:58000150-58000172 CACACTAAGTATCTTAACATGGG - Intergenic
956281207 3:67558947-67558969 CACACTGCTTATCTTGAATAGGG - Intronic
957412639 3:79860878-79860900 CACACTTCTTCTCTTGCCATTGG + Intergenic
959024748 3:101228141-101228163 CACAATCCATAACTAGACATAGG - Intronic
959914388 3:111799709-111799731 CACAATAGATATCTTCACATAGG - Intronic
962193057 3:133331496-133331518 CACACTGGATAGTTTGTCATTGG - Intronic
962443232 3:135442531-135442553 CACATTGCATATCCTAAAATTGG - Intergenic
966800932 3:183763399-183763421 CAGACTGCATATATTAACAGTGG - Intronic
967010213 3:185425990-185426012 CACACTGCATACCATGTAATAGG + Intronic
968044992 3:195619016-195619038 CACAATGGACATATTGACATTGG + Intergenic
968060776 3:195725068-195725090 CACAATGGACATATTGACATTGG + Exonic
969153520 4:5190484-5190506 CACACTGCATTTGGTGTCATGGG + Intronic
970005905 4:11410487-11410509 CCCACAGCATATCTTAGCATAGG - Intronic
970281135 4:14456986-14457008 CACACCGTATATCTTGTCTTGGG + Intergenic
975167867 4:71198493-71198515 CACGCTGCATATCATGAGAATGG + Intronic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
978704933 4:111696755-111696777 AGCACTGCTTATCTTGACTTGGG - Intergenic
979109856 4:116739443-116739465 CACACTGCATATGGTGTCTTAGG + Intergenic
983216118 4:165004656-165004678 CACTCTCCATCTCTTAACATGGG + Intergenic
984530706 4:180912905-180912927 CAGATTTCATATGTTGACATTGG - Intergenic
993334625 5:86642812-86642834 CCCACTGAATATCTTGAGAAAGG - Intergenic
1005449166 6:25956278-25956300 CACAAAGCAAATGTTGACATAGG + Intergenic
1010173111 6:72995632-72995654 CAAACACCATATCTTGACTTTGG - Intronic
1012773213 6:103468133-103468155 CATACTCCATTTCTTCACATTGG - Intergenic
1015731860 6:136357153-136357175 GACACTGAATATCTTTACAAAGG + Intronic
1028286489 7:89009445-89009467 AACACTATATATCTTGACAATGG + Intronic
1028666925 7:93355896-93355918 ATTACTGCATTTCTTGACATTGG - Exonic
1032492769 7:132336392-132336414 CACATTGTATATCCTGATATGGG + Intronic
1032551567 7:132789178-132789200 AACACTGCATAAATTAACATAGG + Intronic
1032909299 7:136411273-136411295 CACACTTCATATTTTTAAATGGG + Intergenic
1032982779 7:137304052-137304074 CACGCTGCATATCTTCCCAAGGG - Intronic
1034752258 7:153581311-153581333 TACACTAGATATCTTGATATAGG - Intergenic
1034824612 7:154250363-154250385 CACACTGCAGGTGTTGACATGGG - Intronic
1034860679 7:154592249-154592271 GACACTGCTTATCTTGACTCAGG + Intronic
1039784317 8:40819332-40819354 CATAACCCATATCTTGACATTGG + Intronic
1040544087 8:48383529-48383551 CACACTTTATATCTGCACATGGG - Intergenic
1042063245 8:64844811-64844833 CACACTGAATAGCATGACAAGGG + Intergenic
1044932209 8:97261072-97261094 CACAAGGCATATCTTGTCGTGGG + Intergenic
1048009031 8:130442101-130442123 CAAACTGCATATTTTGAGATAGG - Intronic
1056526595 9:87448224-87448246 CACACTGACTATATTGACTTTGG + Intergenic
1056667301 9:88590867-88590889 CACACTCCATTTCTTGCCAGAGG - Intergenic
1058503248 9:105643937-105643959 CAAACTGTGTATCTTGACAAAGG + Intergenic
1059978998 9:119748493-119748515 CACACTACATATTTTAACAAAGG - Intergenic
1062564427 9:137157644-137157666 CACACTGCAGATGTTCACTTGGG - Intronic
1186560986 X:10613187-10613209 AACACTCCAAAACTTGACATAGG + Intronic
1194130341 X:90073918-90073940 CTCACTGCATAGTTTCACATGGG + Intergenic
1195914764 X:109925251-109925273 CTTACTGTACATCTTGACATGGG + Intergenic
1196706290 X:118720425-118720447 CACTCTGCATATCTAGCTATTGG - Intergenic
1198466301 X:136907587-136907609 TGCCCTGCAAATCTTGACATGGG + Intergenic
1198954225 X:142109942-142109964 CAAAATGCATATCTTGATCTTGG + Intergenic