ID: 1064864310

View in Genome Browser
Species Human (GRCh38)
Location 10:19861746-19861768
Sequence AGCTCCACCTCAGCTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064864307_1064864310 3 Left 1064864307 10:19861720-19861742 CCTTTTCTGCAGCTCCTCTGACC 0: 1
1: 19
2: 1
3: 53
4: 383
Right 1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG No data
1064864306_1064864310 16 Left 1064864306 10:19861707-19861729 CCAGTCTTTTTGACCTTTTCTGC 0: 1
1: 0
2: 0
3: 21
4: 337
Right 1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064864310 Original CRISPR AGCTCCACCTCAGCTAGAGT TGG Intronic
No off target data available for this crispr