ID: 1064865471

View in Genome Browser
Species Human (GRCh38)
Location 10:19873977-19873999
Sequence ACTTCAGGTGTGGATCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064865465_1064865471 -2 Left 1064865465 10:19873956-19873978 CCAGATTTCCATACTCTTAAAAC No data
Right 1064865471 10:19873977-19873999 ACTTCAGGTGTGGATCTGGGTGG No data
1064865467_1064865471 -10 Left 1064865467 10:19873964-19873986 CCATACTCTTAAAACTTCAGGTG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1064865471 10:19873977-19873999 ACTTCAGGTGTGGATCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064865471 Original CRISPR ACTTCAGGTGTGGATCTGGG TGG Intronic
No off target data available for this crispr