ID: 1064865985

View in Genome Browser
Species Human (GRCh38)
Location 10:19880754-19880776
Sequence AACAGCATGATGTAAGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064865985 Original CRISPR AACAGCATGATGTAAGGTAG AGG (reversed) Intronic
900760818 1:4468988-4469010 AACAGCATGATGTGATGATGGGG - Intergenic
901796814 1:11684278-11684300 ATCAGCATGATGGATGGTTGTGG + Intronic
902131186 1:14261953-14261975 AAAAGCATGATGTATGCCAGTGG - Intergenic
902825322 1:18969418-18969440 AACAGCCAGATGGAAGGTACTGG - Intergenic
908350436 1:63281681-63281703 GGCAGCATGATGAAAGGCAGAGG + Intergenic
908392352 1:63695286-63695308 CACAACATGCTGTGAGGTAGGGG + Intergenic
908535949 1:65077446-65077468 AACAGAATGAAGAAAGTTAGGGG - Intergenic
913350119 1:117848754-117848776 ACCAGCATGATGAAAGGGAGAGG + Intergenic
915087325 1:153397521-153397543 AACAGCATGAAGAAAGTCAGGGG + Intergenic
918455290 1:184705324-184705346 AAGAGCATGATTTAAGTCAGGGG + Intronic
919527590 1:198673009-198673031 AAAAGCAAGATGTAAGGTAGAGG - Intronic
919527864 1:198677376-198677398 AAAAGCAAGATGTAAGGTAGAGG - Intronic
920709373 1:208280439-208280461 ACCAGCTTGATGGAAGGGAGTGG + Intergenic
922185831 1:223273515-223273537 AACAGTATGATGTATGGCAGGGG + Intronic
1063946820 10:11184988-11185010 AAAAGCATGATGTAATGTATAGG + Intronic
1064865985 10:19880754-19880776 AACAGCATGATGTAAGGTAGAGG - Intronic
1065840690 10:29698118-29698140 AACAGCAAGATGTGAGGTTCTGG - Intronic
1066320455 10:34297994-34298016 AACAGCATAATGCTAGGAAGAGG - Intronic
1066645228 10:37600411-37600433 AACAGCATTATGTATGGTAAAGG - Intergenic
1071380737 10:85056879-85056901 TACAGCATGATGCTGGGTAGTGG - Intergenic
1073692175 10:105821280-105821302 AACAGGATGTTTTTAGGTAGAGG + Intergenic
1074222019 10:111447318-111447340 AACAGTATAATTAAAGGTAGGGG + Intergenic
1074749456 10:116570287-116570309 GAATGCATGATGTAAGATAGTGG + Intergenic
1076284937 10:129285697-129285719 AACAGCAGGAGGTAAGCTGGGGG - Intergenic
1078774658 11:14383128-14383150 AACAGGATGGTGGGAGGTAGGGG - Intergenic
1079528594 11:21421177-21421199 ATTAGCATGGTATAAGGTAGTGG + Intronic
1082091934 11:48097281-48097303 ACCAGCATGAACCAAGGTAGGGG + Intronic
1084291160 11:68169090-68169112 AACAGCATGATGGAGAATAGTGG - Intronic
1085795971 11:79540218-79540240 GACAGCACTATGTAAGGTGGAGG + Intergenic
1087746136 11:101949519-101949541 AACAGCAACATTTAAGGAAGTGG + Intronic
1088798303 11:113283204-113283226 AACAGCATCATGCAAAGTACTGG - Intergenic
1092197484 12:6558230-6558252 AACAAGATGCTGTAAGGAAGAGG + Intronic
1092484015 12:8885895-8885917 AGCAACATGCTGTAATGTAGTGG - Intronic
1097803358 12:63939279-63939301 AACGGGAGGATGTAAAGTAGAGG + Intronic
1098747898 12:74264017-74264039 GACAGCATTATGTCAGGTTGTGG - Intergenic
1100285392 12:93161038-93161060 AACAGCAGGATGCAAAGCAGAGG - Intergenic
1103046544 12:117739757-117739779 GACAGGATGAGGTAAGATAGGGG + Intronic
1104091380 12:125520664-125520686 AACAGGATGATGACAGGTAGAGG - Intronic
1104751349 12:131241682-131241704 ATCAGAATGATGTAAGATACTGG - Intergenic
1106598240 13:31165432-31165454 AACACCTTGATGTGGGGTAGGGG - Intergenic
1108009503 13:45990295-45990317 AACAACATAGTTTAAGGTAGTGG - Intronic
1110683528 13:78344899-78344921 TTCAGCATAATGTGAGGTAGAGG + Intergenic
1114502937 14:23184852-23184874 AACAGCATGAAGCAATATAGTGG + Intergenic
1116118358 14:40687982-40688004 AACATAATGATGAAAGGTATTGG + Intergenic
1116764006 14:49048897-49048919 AAGAGAATGATCAAAGGTAGAGG + Intergenic
1118258307 14:64224366-64224388 AAAAGATTGATTTAAGGTAGGGG + Intronic
1119595357 14:75927952-75927974 AACAGGATGGTGTCAGGGAGGGG - Intronic
1120431615 14:84425068-84425090 AACAGCATTATTTTAGTTAGGGG + Intergenic
1125176070 15:36823255-36823277 AACAACATTATGTAAACTAGAGG - Intergenic
1126692963 15:51302144-51302166 AAGAGTATGATGGCAGGTAGAGG - Intronic
1127041225 15:54979050-54979072 AAAAGAAGGATGTAAGCTAGTGG - Intergenic
1127439419 15:58991478-58991500 AACAGAATGGTTTCAGGTAGTGG + Intronic
1127632254 15:60838188-60838210 AACAGCATGCTGGAGAGTAGGGG - Intronic
1131120414 15:89819476-89819498 TACAGCATGATTTAAAATAGGGG + Intergenic
1135316202 16:21447132-21447154 AACAGCATGACGTGAGGCCGTGG - Intronic
1135369127 16:21879392-21879414 AACAGCATGACGTGAGGCCGTGG - Intronic
1135442689 16:22491750-22491772 AACAGCATGACGTGAGGCCGTGG + Intronic
1136090426 16:27915810-27915832 AATAGGATCATGTCAGGTAGCGG + Intronic
1136326313 16:29527622-29527644 AACAGCATGACGTGAGGCCGTGG - Intergenic
1136441002 16:30267607-30267629 AACAGCATGACGTGAGGCCGTGG - Intergenic
1137378580 16:47976498-47976520 AGCAGCATCATGCAAGGAAGAGG - Intergenic
1138525384 16:57602734-57602756 ATGAACATGATGTGAGGTAGGGG - Intergenic
1139887517 16:70219926-70219948 AACAGCATGATGTGAGGCCATGG - Intergenic
1140212791 16:72983943-72983965 AACAGCAAGATGGAAGGTTCTGG - Intronic
1143427343 17:6850508-6850530 AAAATCATGATGGAAGGTGGAGG + Intergenic
1143602832 17:7960518-7960540 CACAGCATGATGTTGGGGAGAGG - Intergenic
1150239178 17:63618471-63618493 TACAGAATGATGGAAGGGAGGGG + Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1155800173 18:30091916-30091938 AACAGCCTCATGTAAGTCAGAGG + Intergenic
1156333243 18:36145592-36145614 CATAGCATAATGTAAGGAAGAGG - Intronic
1157458967 18:47867561-47867583 AACAGCATGATGTTAGGATGAGG - Intronic
1157806012 18:50658067-50658089 AAGAACATGATGGAAGGTGGGGG + Intronic
1159662969 18:71122010-71122032 AACAGAATGATGTAGGGGTGTGG + Intergenic
1160392449 18:78544817-78544839 AAAAGCATGATGTTGAGTAGTGG - Intergenic
1165554970 19:36622684-36622706 AACAATATGATTTAGGGTAGGGG - Intronic
925320366 2:2961695-2961717 CACAGCATTATCTAAGTTAGAGG - Intergenic
930324583 2:49899384-49899406 ACCAGCAAGATGTAACATAGTGG - Intergenic
933556413 2:83836182-83836204 AAGATCATGATTTGAGGTAGTGG - Intergenic
933651095 2:84850859-84850881 AGCAGCATGATGTTAGGTGGTGG - Intronic
933889648 2:86755844-86755866 ATCAGCATGAGGGAATGTAGTGG + Intronic
934473250 2:94574706-94574728 AACTGGATGATGGAAGGTACGGG + Intergenic
941588078 2:167384584-167384606 GACAGCATGAGGGAAGGGAGAGG - Intergenic
942579600 2:177403213-177403235 TACTGCAAGATGTAAGGTATAGG + Intronic
942677237 2:178440681-178440703 GACAGCTTGAACTAAGGTAGTGG - Intronic
943238201 2:185348950-185348972 AACAGCATGATTATAGATAGAGG + Intergenic
943471721 2:188302893-188302915 AATAGCAGGATGTAAGACAGTGG - Intronic
944837008 2:203589794-203589816 AAAAACATTATTTAAGGTAGGGG + Intergenic
947223225 2:227814470-227814492 TACAACATGCTGTAAGGTAAGGG - Intronic
947939841 2:234042724-234042746 AACAGTATGATGTTAGCTATGGG - Intergenic
948315542 2:237025903-237025925 AACAGCATGAGGTCCCGTAGGGG + Intergenic
1168985096 20:2041139-2041161 AACAGCATGAGGAGGGGTAGGGG - Intergenic
1171414955 20:24971659-24971681 TACAGCATGATGTATGGGAAGGG - Intronic
1173909820 20:46658369-46658391 AACAGCATGAGGAAATGTATAGG + Intronic
1182530425 22:30951460-30951482 AAGAGAAGGATGTAAGGCAGAGG + Intronic
1183827608 22:40400798-40400820 ACCAGCACAATGTCAGGTAGAGG + Exonic
1185205956 22:49538905-49538927 CACATCATGATGGAGGGTAGGGG - Intronic
1185226813 22:49658051-49658073 AACAGCATGGTGGCAGGTAGAGG - Intergenic
949896950 3:8774900-8774922 AACTGCATCTTGGAAGGTAGGGG + Intronic
951344338 3:21528550-21528572 AACAATATGATGGAAGGTACTGG + Intronic
952553374 3:34504064-34504086 GACAGCATGATAAAAGGTACAGG - Intergenic
956426713 3:69143856-69143878 ATGAGCATGATGTAAGAGAGTGG - Intergenic
957350042 3:79012873-79012895 AACAGCAAGATTGAAGGAAGGGG + Intronic
957913012 3:86647212-86647234 AAGAGCATGAACTAAGGTAGGGG + Intergenic
959487554 3:106944645-106944667 AATAGCATGATATAAGGTAGAGG + Intergenic
961397438 3:126605503-126605525 TATAGCATGATGGAAAGTAGAGG - Intronic
962612683 3:137093382-137093404 AAAGGAATGATGTTAGGTAGAGG - Intergenic
963004056 3:140709598-140709620 AACAGCATGAAGAAAGGTAGAGG + Intergenic
964335416 3:155649314-155649336 AACAGAATTATATAGGGTAGTGG - Intronic
966598662 3:181752264-181752286 ACCAGAATGATGGAAAGTAGAGG - Intergenic
966817754 3:183903343-183903365 AACAGAATGATGTAGAGCAGTGG + Intergenic
967678363 3:192328275-192328297 AACACTATGATTTAGGGTAGGGG + Intronic
969976706 4:11109907-11109929 CAAAGCATGATGTAAGGCAAAGG - Intergenic
970079981 4:12271366-12271388 AACCACCTGATGTCAGGTAGGGG - Intergenic
970741001 4:19237491-19237513 AATAGCATGAGGTAAGGTTTAGG + Intergenic
973131219 4:46651385-46651407 TTCAGCATGATGTTAGGTATGGG - Intergenic
974207818 4:58729324-58729346 GATAACATGATGAAAGGTAGAGG + Intergenic
975833699 4:78398278-78398300 AAAAGCATGGTCCAAGGTAGAGG - Intronic
976347160 4:84017409-84017431 AACAGCTAGAAGTAAGGCAGAGG - Intergenic
979576618 4:122299617-122299639 AAAAGCATAATGTAAGACAGTGG + Intronic
979904539 4:126270390-126270412 AACAGCATTGTATAAGGTTGGGG - Intergenic
982328749 4:154157996-154158018 AACAGCATGTGCCAAGGTAGTGG + Intergenic
983979830 4:173982048-173982070 TACACCATGATTTCAGGTAGTGG + Intergenic
986794046 5:11191879-11191901 AACAGCAGGATGTGAAGCAGGGG - Intronic
988645060 5:33085805-33085827 AAAATCATGATGTAAGGTGAAGG + Intergenic
988699929 5:33663240-33663262 AGCAGAATGATATATGGTAGAGG + Intronic
990374497 5:55155750-55155772 GCCAGCATGATGGAAGGAAGGGG - Intronic
991073426 5:62512277-62512299 AACAGCAAGATGTGAGGTTCTGG + Intronic
995023093 5:107388362-107388384 AATAGCATGATGGAAGTTACCGG - Intronic
996182131 5:120432146-120432168 AAAAGCATGATTTCAGGGAGGGG + Intergenic
998113340 5:139518430-139518452 AACAGGATGATGACAGGAAGAGG + Intergenic
1000869109 5:166553176-166553198 AGCAGCATGATTTAAAGTATGGG + Intergenic
1002388014 5:178884832-178884854 AACTGCATAATTTATGGTAGTGG + Exonic
1002813628 6:658472-658494 ACCACAATGATGTAAGTTAGAGG + Intronic
1003416277 6:5911216-5911238 AACAGGTTGGTGTGAGGTAGAGG + Intergenic
1004685495 6:17939640-17939662 AACAGCATGAGGTAAAGAAGCGG + Intronic
1004931497 6:20467059-20467081 AAGAGAATGATGAAGGGTAGGGG - Intronic
1007287882 6:40761262-40761284 AAAAGCATGGTGGAAGCTAGGGG + Intergenic
1008203680 6:48626044-48626066 ATGTGAATGATGTAAGGTAGCGG + Intergenic
1011069426 6:83364228-83364250 AGCAGAAAGATGTAGGGTAGGGG - Intronic
1013300211 6:108798208-108798230 ACCAGGATGATGTAAGCGAGCGG + Intergenic
1014781854 6:125573844-125573866 AACAGCCTCCTGTAAGGTAATGG - Intergenic
1016333172 6:142975429-142975451 ATCAGCATGATTCAGGGTAGTGG + Intergenic
1017803533 6:157922048-157922070 AACAGCATGATGGCAGGAAAGGG + Intronic
1020646626 7:10821983-10822005 AACAACATGTTGTAAGGTGATGG - Intergenic
1021191406 7:17623960-17623982 CACACCATGAGGTAAGGGAGGGG + Intergenic
1021425970 7:20499867-20499889 TTCAGCATGATGTTAGGTATGGG - Intergenic
1022839358 7:34148175-34148197 AACAGCAGGAACAAAGGTAGGGG - Intronic
1023316138 7:38939280-38939302 TACAGCAAGAGGAAAGGTAGAGG - Intergenic
1026581362 7:71621224-71621246 CAGAGCATGATGTAAGGCAAGGG - Intronic
1027459434 7:78434691-78434713 AACAGCATCAAGAAAGATAGTGG + Intronic
1028148820 7:87348574-87348596 AACAACATGATAGAAGGTAAGGG - Intronic
1031071570 7:117167566-117167588 AAGAGCAGGATGTTAGGTTGTGG + Intronic
1031207638 7:118781191-118781213 AAAAACATGATATAAAGTAGGGG - Intergenic
1032776382 7:135118144-135118166 AAAAGCATAAGGTAGGGTAGGGG - Intronic
1032832114 7:135638606-135638628 CACAGCATGCTGGAAGGTAGGGG - Exonic
1037570023 8:20150029-20150051 AACAGCATGAGTTAAGTTTGAGG - Intronic
1038159070 8:25019502-25019524 AACAGAATGAAGAAAGGGAGGGG - Intergenic
1039086757 8:33787881-33787903 AACAGCATGAATTAGGGTAAAGG + Intergenic
1043480183 8:80644967-80644989 AACAGCAAGATGTGAGGTTCTGG + Intronic
1044693072 8:94897057-94897079 AACAGCATGATGTCAAGAAAAGG + Intronic
1045668649 8:104520691-104520713 AACAGCCTGATGTAAGTAAGGGG - Intronic
1047340946 8:123980015-123980037 AACAGGCTGATGTAACATAGAGG - Intronic
1047771843 8:128036237-128036259 AACATCATGATGTAAAATAAGGG + Intergenic
1047866503 8:129029715-129029737 AATAACAATATGTAAGGTAGTGG - Intergenic
1048431839 8:134377924-134377946 AGCATCATGATGTCAGGTTGGGG - Intergenic
1048721087 8:137326102-137326124 AATAGCATGATCAAAGGTAAGGG + Intergenic
1048935940 8:139357163-139357185 AACAGCATGATTTCAGGGTGTGG - Intergenic
1050321231 9:4454507-4454529 AACAGCAAGATGTAGGGCAAAGG - Intergenic
1050590156 9:7152246-7152268 AATAGCATTATGTATGATAGGGG + Intergenic
1052394213 9:27918338-27918360 ATGAGTATGGTGTAAGGTAGGGG + Intergenic
1053465970 9:38308812-38308834 AACAGCATGATCAAAGGCACAGG + Intergenic
1053558607 9:39164711-39164733 AACAGAATGTTGTAATGTACAGG + Intronic
1053685086 9:40513813-40513835 AACTGGATGATGGAAGGTACAGG - Intergenic
1053822732 9:41984943-41984965 AACAGAATGCTGTAATGTACAGG + Intronic
1053935049 9:43142099-43142121 AACTGGATGATGGAAGGTACAGG - Intergenic
1054138505 9:61454230-61454252 AACAGAATGTTGTAATGTACAGG - Intergenic
1054278642 9:63111150-63111172 AACTGGATGATGGAAGGTACAGG + Intergenic
1054298178 9:63349270-63349292 AACTGGATGATGGAAGGTACAGG - Intergenic
1054396196 9:64653787-64653809 AACTGGATGATGGAAGGTACAGG - Intergenic
1054430839 9:65158982-65159004 AACTGGATGATGGAAGGTACAGG - Intergenic
1054499542 9:65862539-65862561 AACTGGATGATGGAAGGTACAGG + Intergenic
1054607843 9:67202422-67202444 AACAGAATGCTGTAATGTACAGG - Intergenic
1054952806 9:70872070-70872092 AAGAGCATGATATAAAGTAGTGG + Intronic
1055630424 9:78218243-78218265 AACTGCATGTTGAAAGGTACTGG + Intergenic
1056070833 9:82985026-82985048 AACAGCATGCAGAAAGGCAGAGG + Intronic
1056742058 9:89265896-89265918 AACAGAATGTTCTAAGGTACTGG + Intergenic
1058182268 9:101813149-101813171 AATAGCATTATGTTAGGCAGTGG + Intergenic
1058188699 9:101887185-101887207 AACCATATGATTTAAGGTAGAGG - Intergenic
1058780973 9:108334782-108334804 AACTGAATGAAGTAAGTTAGAGG + Intergenic
1059799143 9:117731925-117731947 AAAAGTATAATGTAAGGAAGTGG - Intergenic
1059994322 9:119893949-119893971 GACAGGATGATGAAAGGAAGGGG + Intergenic
1186303616 X:8229052-8229074 AACAGCATGGTTTAGGGCAGAGG + Intergenic
1188260330 X:28016100-28016122 ATCAGCATGAAGGAAGGAAGTGG + Intergenic
1190477115 X:50839521-50839543 AACAGCATGACTTAAGGAAAAGG - Intergenic
1191743150 X:64457133-64457155 AAAACCAAGATTTAAGGTAGGGG - Intergenic
1194776586 X:97972831-97972853 AAATGCATGATATAAGGGAGAGG - Intergenic
1198456954 X:136826258-136826280 TACATCATGATCTCAGGTAGTGG - Intergenic