ID: 1064867017

View in Genome Browser
Species Human (GRCh38)
Location 10:19892278-19892300
Sequence GGCGAATGTCTGTGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064867013_1064867017 18 Left 1064867013 10:19892237-19892259 CCACTTAAGGAGGTCTGTGCTAT 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1064867017 10:19892278-19892300 GGCGAATGTCTGTGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064867017 Original CRISPR GGCGAATGTCTGTGGCATGG TGG Intronic
No off target data available for this crispr